DMD Simcyp

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, Y.
Right arrow Articles by Halpert, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kobayashi, Y.
Right arrow Articles by Halpert, J. R.

Vol. 26, Issue 10, 1026-1030, October 1998

Catalytic Properties of an Expressed Cytochrome P450 2b1 From a Wistar-Kyoto Rat Liver cdna Library

Yasuna Kobayashi,1 Sharon M. Strobel, Nancy Eddy Hopkins, William L. Alworth, and James R. Halpert

Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona (Y.K., S.M.S., J.R.H.); Department of Pharmacology, Tulane Medical School (N.E.H.); and Department of Chemistry,Tulane University (W.L.A.)

    Abstract
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

Cytochrome P450 2B1 clones were isolated from a phenobarbital-induced Wistar-Kyoto (WKY) hepatic cDNA library and were found to contain a Glu-322 right-arrow Val substitution, compared with wild-type 2B1 from Sprague-Dawley rats. After heterologous expression in Escherichia coli and purification, activities of this 2B1 E322V variant were determined for ethoxycoumarin and androstenedione. The total activities and metabolite profiles did not differ between 2B1 E322V and wild-type 2B1 for these substrates. In addition, similar rate constants of inactivation were observed with the mechanism-based inactivators chloramphenicol, N-(2-p-nitrophenethyl)chlorofluoroacetamide, and 9-ethynylphenanthrene. These results suggest that the Glu-322 right-arrow Val alteration in the 2B1 WKY variant does not significantly affect 2B1 activity. However, another clone obtained from the cDNA library contained two additional substitutions: Val-103 right-arrow Ala and Glu-424 right-arrow Lys. As residue 103 is within a predicted substrate recognition site (SRS-1), it was of interest to determine whether the Val right-arrow Ala substitution conferred any unique catalytic activities on 2B1. No differences in the metabolism of ethoxycoumarin or androstenedione were observed. However, the Val-103 right-arrow Ala alteration caused an approximately threefold decrease in the rate constant of inactivation for 9-ethynylphenanthrene in comparison with either 2B1 E322V or wild-type 2B1. Based on computer modeling, residue 103 is predicted to be near the active site but at a distance greater than 5Å from 9-ethynylphenanthrene. Our results suggest that the Val-103 right-arrow Ala alteration may have an indirect influence on the susceptibility of P450 2B1 to mechanism-based inactivators.

    Introduction
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

The cytochrome P450 superfamily consists of multiple P4502 gene products that play an important role in the detoxification and metabolic activation of a large number of endogenous and exogenous substances (Nelson, 1995). Members of the 2B subfamily have provided an excellent framework to study P450 structure/function because of their high sequence homology and distinct substrate specificities. Approaches that have been instrumental in the identification of substrate contact residues include the isolation and analysis of allelic variants with altered substrate specificity, the analysis of site-directed mutants constructed on the basis of sequence differences between closely related members of the same subfamily, or predictions based on computer homology modeling. Among the determinants of substrate specificity that have been identified by these means are residues 114, 206, 209, 302, 363, 367, 477, 478, and 480 (Kedzie et al., 1991; He et al., 1992; Aoyama et al., 1989; Halpert and He, 1993; He et al., 1994; He et al., 1995; Szklarz et al., 1995).

Many of the residues important in substrate specificity are also involved in the susceptibility of P450s to mechanism-based inactivation. Orientation of the inactivator within the enzyme active site is critical to determining whether the reactive intermediate will be formed and whether this intermediate will react with the heme or apoprotein to result in covalent modification and enzyme inactivation. Thus mechanism-based inactivators have proved to be valuable probes of P450 function by differentiating between closely related enzymes. In particular, chloramphenicol and related analogs are highly selective, as these compounds are able to distinguish between 2B1 enzymes with single amino acid substitutions at residue 478 (Kedzie et al., 1991; He et al., 1992; Halpert and He, 1993) or between 2B1 and 2B2 variants (Strobel and Halpert, 1997). Aryl acetylenic compounds have also been shown to be mechanism-based inactivators of P450 enzymes, resulting in modification of either the heme moiety or the apoprotein (Ortiz de Montellano and Kunze, 1980). Many of these compounds are also selective in their inactivation (Hopkins et al., 1992; Foroozesh et al., 1997; Roberts et al., 1996); for example, 9-ethynylphenanthrene inactivates 2B1, 2B4, 2B11, but not 1A1 (Hopkins et al., 1992).

The current study characterizes heterologously expressed 2B1 cDNA clones isolated from Wistar-Kyoto (WKY) rats by examination of their substrate specificity and susceptibility to mechanism-based inactivators. We have previously shown that microsomes from WKY rats exhibited approximately twofold-higher 16beta androstenedione hydroxylase activity, compared with other phenobarbital-induced microsomal preparations (Kedzie et al., 1991). However, the molecular basis for this difference remained unclear. Since alterations in androstenedione hydroxylase activity may indicate the presence of an allelic variant of 2B1, we have isolated and heterologously expressed P450 2B1 from a WKY rat liver cDNA library. Characterization of the 2B1 WKY variant that contained a single Glu-322 right-arrow Val alteration revealed that it did not significantly differ from wild-type 2B1 in its activities or susceptibility to inactivation. In addition, the affect of an alteration at residue 103 was examined. Although this residue is not predicted to be a substrate contact residue based on computer homology modeling, the Val-103 right-arrow Ala substitution decreased the susceptibility of 2B1 to inactivation by 9-ethynylphenanthrene.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

Materials. Primers were synthesized by the University of Arizona Macromolecular Structure Facility (Tucson, AZ) or by National Biosciences, Inc. (Plymouth, MN). Restriction endonucleases, Taq polymerase, media for bacterial growth, and the 3' RACE kit were purchased from Gibco-BRL (Grand Island, NY). The Sequenase 2.0 dideoxy sequencing kit was purchased from the United States Biochemical Corp. (Cleveland, OH). The E. coli strain Topp3 was purchased from Stratagene (La Jolla, CA). Androstenedione, NADPH, diauroyl-L-3-phosphatidyl choline, chloramphenicol, BioMax MR-1 film, and CHAPS were purchased from Sigma Chemical Co. (St. Louis, MO). Guanidinium thiocyanate was obtained from Fluka BioChemika (Ronkonkoma, NY). HEPES was purchased from Calbiochem Co. (La Jolla, CA). [4-14C]Androstenedione was purchased from DuPont-New England Nuclear (Boston, MA). TLC plates [silica gel, 250 mM, Si 250PA (19C)] were purchased from J.T. Baker, Inc. (Phillipsburg, NJ). Rat NADPH cytochrome P450 reductase was expressed in E. coli as described previously (Harlow and Halpert, 1997). N-(2-p-nitrophenethyl)chlorofluoroacetamide and 9-EPh were synthesized as described previously (Hopkins et al., 1992; Halpert et al., 1990; Hall et al., 1990). All other chemicals and supplies used were of the highest grade commercially available.

Isolation of P450 2B1 cDNA Clones. Two male WKY rats (180-220 g) were obtained from Harlan Sprague-Dawley (Indianapolis, IN). To induce hepatic P450s, rats were given 0.1% sodium phenobarbital (Mallinckrodt, Inc., St. Louis, MO) in the drinking water for 4 consecutive days. Rats were sacrificed and the livers were harvested. Hepatic mRNA isolation by the guanidinium thiocyanate method, cDNA library construction using the 3' RACE kit, and cloning of 2B1 cDNAs into pSE380 were performed as previously described (Kedzie et al., 1991; Strobel and Halpert, 1997). PCR amplification conditions were as previously described (Strobel and Halpert, 1997) with the following exceptions: Taq DNA polymerase was used instead of Deep Vent Polymerase, and annealing temperatures were 45°C for the first five cycles, followed by 55°C for the remaining 25 cycles. Two full-length 2B1 cDNA clones were sequenced by the University of Arizona Macromolecular Structure Facility or by double-stranded sequencing using Sequenase. For the construction of 2B1 E322V with the Val-103 right-arrow Ala substitution, the NcoI/BamHI fragment encoding residues 1-165 from the cDNA clone 2B1 E322V/V103A/E424K (containing this substitution in addition to one at codon 424) was ligated into pSE2B1 E322V (encoding wild-type sequence at codons 103 and 424). Sequencing confirmed the presence of an alanine codon at position 103 and a glutamic acid codon at position 424.

Additional WKY 2B1 clones were obtained through RT-PCR. Reaction conditions were as follows: 50 mM Tris pH 8.3, 75 mM KCl, 3 mM MgCl2, 0.5 mM dNTPs, 1 mM DTT, 0.4 U/ml RNasin (Promega), 4U/ml Superscript II RT (Gibco-BRL), and 15 min incubation at 45°C. Taq polymerase was then added to initiate PCR, with the same amplification conditions as described above. The PCR product was then reamplified with a new 5' primer (CCCAAGCTTCCTTCATGCAGCTTCGA) that hybridized in the region of codon 58 and contained a HindIII restriction site. The annealing temperatures used for PCR amplification were 53°C for the first 5 cycles and 60°C for the next 25 cycles, with other amplification conditions as listed above. After digestion with HindIII, the 1100bp insert was isolated and ligated into pSE380 that was digested with HindIII and treated with phosphatase.

Expression of P450 WKY 2B1 Clones in E. coli. The 2B1 cDNA clones were expressed in Topp3 cells as described previously (He et al., 1995; John et al., 1994). The total P450 content was measured by reduced CO spectrum (Omura and Sato, 1964), and expression levels of P450 were determined by measuring this spectra from sonicated whole-cell preparations. CHAPS-solubilized membrane preparations were performed as previously described (John et al., 1994).

Purification of Recombinant P450 2B1. Recombinant P450 2B1 enzymes were purified using the two-column protocol as previously described (Fang et al., 1997). In brief, 30 nmol of P450 from a CHAPS-solubilized membrane preparation was applied onto an equilibrated n-octylamino-Sepharose column. P450 fractions were eluted by buffer containing 0.1% Emulgen 913. After dialysis overnight, the pooled P450-containing fractions were applied to a hydroxyapatite column for removal of detergent. After elution, P450-containing fractions were dialyzed, aliquoted, and stored at -70°C until use. This procedure typically yields protein with a specific content of 13-14 nmol/mg (Fang et al., 1997). The purity of P450 2B1 was confirmed by sodium dodecyl sulfate/polyacrylamide gel electrophoresis (Laemmli, 1970).

Purification of WKY Rat Liver P450 2B1. The WKY rat liver P450 2B1 enzyme was purified from phenobarbital-induced liver microsomes as described previously (Halpert et al., 1982). In brief, microsomal P450 was solubilized with 0.6% sodium cholate, applied onto an n-octylamino-Sepharose column, and P450 enzymes were eluted with buffer containing 0.08% Lubrol PX. The eluted fractions were analyzed at 417 nm, pooled, dialyzed overnight, then applied onto a DEAE-Sephacel column. A linear gradient of 25 mM to 100 mM NaCl in buffer was used to elute and separate the P450 isozymes. The purity of eluted P450 2B1 was confirmed by sodium dodecyl sulfate/polyacrylamide gel electrophoresis.

Androstenedione Hydroxylase and 7-Ethoxycoumarin O-Deethylase Assays. Androstenedione hydroxylase activity was measured as described (He et al., 1995; John et al., 1994; Szklarz et al., 1996). The final 100 µl reaction mixture contained 10 pmol of purified recombinant P450, 20 pmol of reductase (Harlow and Halpert, 1997), 20 pmol of rat liver cytochrome b5, 30 µg/ml of dilauroyl-L-3-phosphatidyl choline, 1 mM NADPH, 2.5 nmol of [14C]-androstenedione in 50 mM HEPES (pH 7.6), 15 mM MgCl2, and 0.1 mM EDTA. After addition of 1 mM NADPH, reactions proceeded for 5 min. Hydroxylated metabolites of androstenedione were developed on TLC plates by two cycles of chromatography in ethyl acetate/chloroform (2:1, v/v). 7-Ethoxycoumarin O-deethylase activity was assayed as described previously (He et al., 1995; Grimm et al., 1994). After reconstitution, P450 (10 pmol) was incubated with substrate for 5 min at 37°C. The concentration of the product (7-hydroxycoumarin) was determined from its fluorescence with an excitation wavelength of 366 nm and emission wavelength of 454 nm (Miller and Halpert, 1986).

Mechanism-Based Inactivation. Inactivation studies were performed as described previously (Kedzie, 1991; He et al., 1992; He et al., 1995). 9-EPh was added from a 100 µM dimethylsulfoxide stock solution to a final concentration of 1 µM, and chloramphenicol and N-(2-p-nitrophenethyl)chlorofluoroacetamide were added from 5 mM and 25 mM methanol stock solutions to a final concentration of 50 and 250 µM, respectively. Reconstituted P450 samples were preincubated with or without inhibitor for 2 or 5 min at 37°C. Reactions were started by the addition of 1 mM NADPH and were allowed to proceed for various times, at which point 10 µl and 25 µl aliquots were removed and added to 190 µl or 75 µl of [14C]androstenedione, for experiments with 9-EPh and chloramphenicol, respectively. Aliquots were removed at either 20, 40, 60, 90, 120, and 180 sec, or 60, 90, 120, 180, 300 sec. One third of the reaction mixture was spotted onto a TLC plate, and the 16beta -OH androstenedione product was quantitated by scintillation counting. Rate constants for inactivation were calculated by linear regression analysis of the natural logarithm of the residual activity as a function of time. The extent of reversible (competitive) inhibition was estimated from the decrease in the extrapolated activity at zero preincubation time, compared with the methanol or dimethylsulfoxide control.

Mass Spectrometry Analysis. The mass spectrometry analysis of hepatic purified 2B1 from WKY rats was as previously described (Strobel and Halpert, 1997) except that 2 nmol of hepatic purified 2B1 protein was dialyzed against 0.2M ammonium bicarbonate (pH 8.0) prior to trypsin digestion. The tryptic fragments of interest were sequenced using positive ion electrospray tandem mass spectrometry with collision-induced dissociation, as previously described (Strobel and Halpert, 1997).

    Results and Discussion
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

Isolation and Characterization of the P450 2B1 E322V Variant. We previously observed higher androstenedione 16beta -hydroxylase activities in microsomes from WKY rats (Kedzie et al., 1991). As this activity is attributed to 2B1 (Wood et al., 1983), and 2B1 variants with altered catalytic activities have been previously isolated, we constructed a cDNA library and obtained P450 2B1 clones from WKY rats. When these 2B1 cDNA sequences were compared with the first reported 2B1 sequence (Fujii-Kuriyama et al., 1983), a silent mutation was found at position 354 (CAC to CAT), and a second mutation was found at position 322 (GAG to GTG), resulting in a change from a glutamic acid to a valine codon. This WKY 2B1 variant will be designated 2B1 E322V. The same E322V alteration has also been observed in 2B2 cDNA clones (Mizukami et al., 1983). To establish whether this alteration affected 2B1 activity, metabolism of ethoxycoumarin and androstenedione was examined. These two substrates have been previously used to assay 2B1 function (Kedzie et al., 1991; He et al., 1992; Halpert and He, 1993; He et al., 1994). For these experiments, 2B1 was obtained either from heterologous expression in E. coli, or from WKY rat liver. As seen in table 1, no significant differences were observed between the activities of either heterologously expressed 2B1 E322V or WKY hepatic purified 2B1, compared with wild-type 2B1. Consistant with this result, residue 322 is not within one of the predicted substrate recognition sites (Gotoh, 1992). Since the 16beta -androstenedione hydroxylase activity of either 2B1 E322V or WKY hepatic purified 2B1 was not significantly higher than that of wild-type 2B1, the basis for the increased activity observed with microsomes remains unknown.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
Catalytic activities of purified P450 2B1 enzymesa

Characterization of Additional 2B1 E322V Enzymes Containing a V103A Alteration. The predicted amino acid sequence of one of the cDNA clones obtained from the cDNA library contained two substitutions in addition to the E322V alteration: Val-103 right-arrow Ala (GTG to GCG) and Glu-424 right-arrow Lys (GAA to AAA). Partial sequence analysis of 4 clones from the same PCR reaction and 46 clones from an independent RT-PCR reaction failed to yield a second clone with an alanine codon at position 103. Thus we were unable to establish whether this clone represents a minor 2B1 variant or a PCR-generated mutant. However, as residue 103 is within a substrate recognition site (SRS-1) and differs between 2B1 and 2B6 (Yamano et al., 1989), it was of interest to determine whether this alteration would affect the catalytic activities of 2B1. In addition, alterations at this position of 2B1 have not been previously examined. The alteration at residue 424 would not be predicted to affect substrate specificity, as it does not lie within an SRS region. The cDNA clone containing the V103A, E322V, and E424K substitutions is designated 2B1 E322V/V103A/E424K. An additional clone was generated that contained only the V103A and E322V alterations, and this clone is designated 2B1 E322V/V103A.

A similar rate of androstenedione metabolism was observed for 2B1 E322V/V103A/E424K as for 2B1 E322V and wild-type 2B1, with the 16beta -OH metabolite representing the major product, and similar ratios of 16beta /16alpha hydroxylated metabolites produced (data not shown). Based on their ability to differentiate between closely related 2B1 enzymes, three well-established inactivators of 2B1 were assessed for their ability to distinguish between the WKY 2B1 enzymes. Both 2B1 E322V and 2B1 E322V/V103A/E424K were susceptible to inactivation by chloramphenicol and one of its analogs, N-(2-p-nitrophenethyl)chlorofluoroacetamide, with similar rate constants of inactivation and extent of reversible inhibition (table 2). These rate constants of inactivation were similar to those previously found for wild-type 2B1 (He et al., 1992; He et al., 1995). However, differences were observed for inactivation of 2B1 enzymes by 9-EPh. A threefold lower rate constant of inactivation was observed for 2B1 E322V/V103A/E424K, compared with 2B1 E322V or wild-type 2B1 (table 3). This result suggested that residues 103 and/or 424 may influence the ability of 2B1 to be inactivated by 9-EPh. Based on these findings, inactivation of 2B1 E322V/V103A, which does not contain the E424K alteration, was analyzed. As shown in fig. 1, preincubation of 2B1 E322V with 9-EPh led to a rapid loss of 16beta -hydroxylase activity, whereas the 2B1 E322V/V103A enzyme was less sensitive to inactivation. A 2.7-fold difference in the rate constants of inactivation between 2B1 E322V and 2B1 E322V/V103A was observed (table 3), indicating that residue 103 influences the ability of 9-EPh to inactivate 2B1. As seen in fig. 1, biphasic kinetics were observed for 2B1 inactivation by 9-EPh, as has been previously observed for numerous other inactivators (Grimm et al., 1995). For experiments with 9-EPh, the rate constants of inactivation were determined from the slope of the first phase, including the first three or four time points. It is interesting to note that 2B1 enzymes with the V103A alteration resemble P450 2B4 and 2B11, which also show a nearly twofold reduction in susceptibility to inactivation by 9-EPh when compared with 2B1 (Roberts et al., 1996).

                              
View this table:
[in this window]
[in a new window]
 

TABLE 2
Rate constants for inactivation of purified 2B1 enzymesa

                              
View this table:
[in this window]
[in a new window]
 

TABLE 3
Rate constants for inactivation by 9-EPha


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of preincubation with 1 µM 9-EPh on androstenedione 16beta -hydroxylase activity in P450 2B1 E322 and 2B1 E322V/V103A.

Open circles, dimethylsulfoxide control (for 2B1 E322V/V103A); closed circles, 2B1 E322V/V103A; closed squares, 2B1 E322V. Reactions were initiated by addition of 1 mM NADPH. At the indicated times, 10-µl aliquots representing 10 pmol of P450 were removed and assayed. The lines shown were generated by linear regression analysis of the natural logarithm of the residual androstenedione hydroxylase activity as a function of time. Control values were all < 0.01 min-1.

Mass Spectrometry. Mass spectrometry was used to determine whether 2B1 E322V/V103A/E424K could be detected in the WKY hepatic purified 2B1 preparation. After digestion with trypsin, peptides were separated by HPLC and analyzed by mass spectrometry. The tryptic peptide containing residue 103 has a predicted mass of 1187.4 for 2B1 E322V, and a predicted mass of 1159.4 for 2B1 E322V/V103A. Fragments with m/z ratios of 1188 and 594.5 were obtained, consistent with a tryptic fragment from 2B1 E322V containing residues 99-109. The presence of valine at position 103 as well as the rest of the sequence in this peptide was confirmed by tandem mass spectrometry (data not shown). However, no abundant ions with the predicted m/z ratio for this tryptic fragment from 2B1 E322V/V103A/E424K could be detected. Along with the inability to find an additional cDNA clone, these results suggest that the 2B1 E322V/V103A/E424K is not likely to be a predominant variant of WKY rats. A less likely alternative is that the 2B1 E322V/V103A/E424K protein may not copurify with 2B1, and thus would not be represented in these experiments.

Computer Modeling. Since the Val right-arrow Ala alteration at residue 103 influences inactivation by 9-EPh, location of this residue relative to the active site was examined in the 2B1 homology model (fig. 2). However, as 9-EPh is an estimated 10-11Å from residue 103, it is unlikely to contact the inactivator directly. Previous studies of 2B1 inactivation by 9-EPh have demonstrated that the peptide Phe297-Leu307 is the site of covalent modification (Roberts et al., 1995). This region is part of helix I, which is not in close approximation to residue 103. The V103A alteration may cause an increase in the size of the active site, thereby altering the orientation of 9-EPh and, thus, its ability to covalently modify the enzyme. This may be accomplished by altering the conformation of the sheet next to helix B', which contains the active site residues 363 and 367. In addition, helix B' is the most highly variable region among P450s and thus difficult to predict by modeling. Repositioning of this helix in the enzyme model may bring residue 103 closer to the active site and into a position more suggestive of a direct role on substrate orientation.


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 2.   9-Ethynylphenanthrene docked into the active site of the P450 2B1 enzyme. Residue 103 of 2B1 is approximately 10-11 Å from 9-EPh.

In conclusion, the present study isolated 2B1 cDNA clones from WKY rats. Characterization of the 2B1 E322V variant revealed that it did not differ from 2B1 wild-type in its activities, and thus the Glu-322 right-arrow Val alteration does not influence 2B1 activity. In the course of this study, a clone containing a Val-103 right-arrow Ala alteration was found. Characterization of 2B1 E322V/V103A revealed that the ability of the enzyme to be inactivated by 9-EPh, but not chloramphenicol or one of its analogs, was reduced almost threefold. The basis for diminished inactivation by 9-EPh is unclear, however, and analysis of other substitutions at this position may provide further information regarding the role of this residue in mechanism-based inactivation.

    Acknowledgment

The authors gratefully acknowledge Dr. Grazyna D. Szklarz for docking of 9-EPh in the active site of the P450 2B1 model.

    Footnotes

Received February 26, 1998; accepted June 10, 1998.

1 Current address: Department of Clinical Pharmacy, School of Pharmaceutical Sciences, Showa University, 1-5-8 Hatanodai, Shinagawa-Ku, Tokyo 142, Japan.

This work was supported by Grant ES03619 and Center Grant ES06694 from the National Institutes of Health.

Send reprint requests to: Sharon Strobel, Department of Pharmacology and Toxicology, 301 University Boulevard, University of Texas Medical Branch, Galveston, TX 77555.

    Abbreviations

Abbreviations used are: P450, cytochrome P450; WKY, Wistar-Kyoto; CHAPS, 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonic acid; reductase, NADPH-cytochrome P450 reductase; RT, reverse transcriptase; PCR, polymerase chain reaction; SRS, substrate recognition site; TLC, thin-layer chromatography; 9-EPh, 9-ethynylphenanthrene.

    References
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References


0090-9556/98/2610-1026-1030$02.00/0
DRUG METABOLISM AND DISPOSITION
Copyright © 1998 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Kumar, E. E. Scott, H. Liu, and J. R. Halpert
A Rational Approach to Re-engineer Cytochrome P450 2B1 Regioselectivity Based on the Crystal Structure of Cytochrome P450 2C5
J. Biol. Chem., May 2, 2003; 278(19): 17178 - 17184.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, Y.
Right arrow Articles by Halpert, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kobayashi, Y.
Right arrow Articles by Halpert, J. R.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition