DMD Simcyp

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fischer, V.
Right arrow Articles by Vickers, A. E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fischer, V.
Right arrow Articles by Vickers, A. E. M.

Vol. 26, Issue 8, 802-811, August 1998

The Multidrug Resistance Modulator Valspodar (PSC 833) Is Metabolized by Human Cytochrome P450 3A
Implications for Drug-Drug Interactions and Pharmacological Activity of the Main Metabolite

Volker Fischer, Alicia Rodríguez-Gascón, Francis Heitz, Ronald Tynes, Christian Hauck, Dalia Cohen, and Alison E. M. Vickers

Preclinical Safety (V.F., A.R.-G., F.H., R.T., C.H., A.E.M.V.) and Oncology Research Group (D.C.), Novartis Pharmaceuticals

    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The metabolism of valspodar (PSC 833; PSC), which is developed as a multidrug resistance-reversing agent, was investigated to assess the potential for drug-drug interactions and the pharmacological activity of major metabolites. The primary metabolites of PSC produced by human liver microsomes were monohydroxylated, as revealed by LC/MS. The major site of hydroxylation was at amino acid 9, resulting in M9, as determined by cochromatography with synthetic M9. Dihydroxylated and N-demethylated metabolites were also detected. PSC metabolism in two human livers exhibited KM values of 1.3-2.8 µM. The intrinsic clearance was 9-36 ml/min/kg of body weight. PSC biotransformation was cytochrome P450 (CYP or P450) 3A dependent, based on chemical inhibition and on metabolism by Chinese hamster ovary cells expressing CYP3A. Ketoconazole was a competitive inhibitor (Ki = 0.01-0.04 µM). The inhibition by 27 compounds, including four antineoplastic agents, corresponded to the inhibitory potentials of these compounds toward CYP3A. For vinblastine, paclitaxel, doxorubicin, and etoposide, the IC50 values were 5, 12, 20, and 150 µM, respectively. M9 was also an inhibitor, with a lower apparent affinity for CYP3A (IC50 = 21 µM), compared with that of PSC. M9 was also less active as a multidrug resistance-reversing agent. M9 demonstrated low potency in sensitizing resistant cells to paclitaxel and was a poor inhibitor of rhodamine-123 efflux from paclitaxel-resistant cells. In addition, compared with PSC, a higher concentration of M9 was needed to compete with the photoaffinity labeling of P-glycoprotein. Conversely, PSC inhibited only reactions catalyzed by CYP3A, including cyclosporine A metabolism (IC50 = 6.5 µM) and p-hydroxyphenyl-C3'-paclitaxel formation (Ki = 1.2 µM). Thus, PSC behaves in a manner very similar to that of other cyclosporines, and a comparable drug-drug interaction profile is expected.

    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The development of MDR1 by the overexpression of the multidrug transporter Pgp is one of the major impediments to cancer chemotherapy (Pastan and Gottesman, 1988). Pgp is a member of a large multigene family of ATP-binding cassette membrane transporters and transports basic or neutral amphiphilic compounds, including some anticancer drugs, i.e. the epipodophyllotoxins (etoposide and teniposide), the anthracyclines (doxorubicin and daunorubicin), the Vinca alkaloids (vincristine and vinblastine), and the taxanes (paclitaxel), out of cells (Pastan and Gottesman, 1991; Higgins, 1992). CSA is an effective MDR-reversing agent through its inhibition of the Pgp transport of anticancer agents (Nooter et al., 1990; Sonneveld and Nooter, 1990; Lehnert et al., 1993). Drawbacks to the use of CSA to reverse MDR in cancer therapy include its immunosuppressive action and the potential for renal side effects at the doses necessary to reverse MDR.

PSC is a new cyclosporine derivative that is superior to CSA as an MDR inhibitor. PSC is a very potent inhibitor of Pgp, being approximately 10-fold more potent than CSA, and has the safety advantage that it would not compromise patients because it lacks immunosuppressive activity and nephrotoxicity (Boesch et al., 1991; Twentyman and Bleehen, 1991; Te Boekhorst et al., 1992). In preclinical studies, the chemosensitizing effect of PSC was dose dependent. PSC significantly prolonged survival times of MDR-P388 tumor-bearing mice when combined with doxorubicin (Boesch et al., 1991) and increased the sensitivity toward etoposide of human carcinoma xenografts in nude mice (Keller et al., 1992). Furthermore, clinical treatment with PSC resulted in increased intracellular accumulation of doxorubicin and vincristine in Pgp-positive myeloma cells (Sonneveld et al., 1994).

The combination of PSC with a chemotherapeutic agent resulted in marked changes in the pharmacokinetics of the anticancer drugs. In clinical trials, administration of PSC resulted in increased neutropenia and significantly increased blood concentrations of doxorubicin, paclitaxel, and etoposide (Fisher and Sikic, 1995). Possible explanations for the reduced blood clearance of the anticancer agents in the presence of PSC include metabolic interactions at P450 and/or reduced elimination via the bile because of PSC inhibition of the biliary ATP-dependent carriers (Böhme et al., 1993).

PSC maintains a cyclic undecapeptide structure, like CSA. The clearance of CSA is dependent on biotransformation, and most drug-drug interactions are metabolic (Campana et al., 1996). PSC, like CSA, was slowly eliminated as metabolites in the bile in rats and dogs. PSC was also eliminated as metabolites after a single oral dose in human subjects, with <0.1% of the dose appearing as unchanged PSC in the urine and <14% (likely the result of unabsorbed PSC) appearing in the feces (Hauck C, personal communication).

Because the available data for PSC indicate a potential for drug-drug interactions similar to those of CSA and because PSC is intended to be used in combination therapy with anticancer agents, metabolic interactions were investigated using human liver tissue in vitro. Potential clinical consequences are predicted based on the enzyme(s) involved in metabolism and based on the reciprocal effects on biotransformation of PSC and potentially coadministered drugs.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Chemicals. Unlabeled PSC, [3H]PSC (518 GBq/mmol), and [14C]PSC (1.96 GBq/mmol) [cyclo-[(N-methyl)-3-oxo-5-[1(E)-propenyl]-L-leucyl-L-[[2,3,4-3H] or [1-14C]]valyl-sarcosyl-(N-methyl)-L-leucyl-L-valyl-(N-methyl)-L-leucyl-L-alanyl-D-alanyl-(N-methyl)-L-leucyl-(N-methyl)-L-leucyl-(N-methyl)-L-valine]], the PSC metabolite M9 [cyclo-[(N-methyl)-3-oxo-5-[1(E)-propenyl]-L-leucyl-L-valyl-sarcosyl-(N-methyl)-L-leucyl-L-valyl-(N-methyl)-L-leucyl-L-alanyl-D-alanyl-(N-methyl-4-hydroxy)-L-leucyl-(N-methyl)-L-leucyl-(N-methyl)-L-valine]], unlabeled and 14C-labeled tropisetron (1.98 GBq/mmol) [1H-indole-3-[14C]carboxylic acid (1"H,5"H)-8-methyl-8-azabicyclo[3.2.1]oct-3"-yl-ester], unlabeled and 14C-labeled ondansetron (1.60 GBq/mmol) [1,2,3,4-tetrahydro-9-methyl-3-[(2-methyl-1H-imidazol-1-yl)-[14C]methyl]carbazol-4-one], bromocriptine, CSA, etoposide, fluvastatin, diclofenac, and (S)-mephenytoin were all from Novartis Pharma Inc. (Basel, Switzerland). The purity of labeled PSC was >97% and that of labeled tropisetron and ondansetron was >98%, as assessed by HPLC.

[3H]CSA (374 GBq/mmol), [14C]doxorubicin (2.11 GBq/mmol), [14C]chlorzoxazone (2.18 GBq/mmol), [14C]tolbutamide (2.00 GBq/mmol), and (S)-[14C]mephenytoin (2.22 GBq/mmol) were obtained from Amersham International plc (Little Chalfont, UK). [3H]Paclitaxel (618 GBq/mmol) was obtained from Moravek Biochemicals (Brea, CA). Antipyrine, chlorpropamide, chlorzoxazone, cholchicine, cimetidine, dextromethorphan, doxorubicin, erythromycin, ethynylestradiol, glyburide, ketoconazole, nifedipine, [14C]phenacetin (0.46 GBq/mmol), quinidine, sparteine, paclitaxel, tolbutamide, vinblastine, and theophylline and its metabolites (1-methyluric acid, 1,3-dimethyluric acid, 3-methylxanthine, and 1-methylxanthine) were purchased from Sigma Chemical Co. (St. Louis, MO). [3H]Glyburide (1887 GBq/mmol) was from DuPont de Nemours (Brussels, Belgium). 4-Hydroxymephenytoin, bufuralol, and hydroxybufuralol were obtained from Ultrafine Chemicals (Manchester, UK). [14C]Theophylline (1.93 GBq/mmol) was obtained from Anawa Trading SA (Wangen, Switzerland), and unlabeled phenacetin was from Fluka (Buchs, Switzerland). Lovastatin was a gift from Merck Sharp and Dome (Rahway, NJ), and doxorubicinol was synthesized by Mercian (Tokyo, Japan). All other reagents were obtained from commercial sources and were of the highest grade available.

Human Liver Preparations. Human liver tissue that could not be used for transplantation was obtained as either pieces or microsomes from the International Institute for the Advancement of Medicine (Exton, PA) (HHM-0011 and GGM-002) or from Vitron Inc. (Tucson, AZ) (HL-44). Microsomes from livers GGM-002 and M8 were prepared by differential centrifugation as previously described (Ball et al., 1992). Microsomal protein concentrations were determined by the method of Bradford (1976), and the P450 contents were determined from spectra obtained with carbon monoxide according to the method of Omura and Sato (1964). Total P450 contents were 0.89, 0.44, 0.29, and 0.23 nmol of P450/mg of protein for microsomal preparations HHM-0011, GGM-002, M8, and HL-44, respectively. Human liver S9 fractions EOH 368-04 and EJS 882-08 were obtained from Human Biologics Inc. (Phoenix, AZ) and exhibited P450 contents of 0.070 and 0.082 nmol/mg of protein, respectively.

Recombinant Human Proteins. cDNA encoding either CYP3A4, CYP3A5, or CYP2D6 was cloned from human liver mRNA that was reverse-transcribed into first-strand cDNA and subjected to amplification by polymerase chain reaction. Specific oligonucleotides were used that spanned full-length P450, with CYP3A4-back and CYP3A4-forward primers (5'-agataagtaaggaaagtagtgatggc and 5'-tggatgaagcccatcttcatttcaga, respectively), CYP3A5-back and CYP3A5-forward primers (5'-agataagtaaggaaagtagtgatggc and 5'-tggatgaagcccatcttcatttcaga, respectively), and CYP2D6-back and CYP2D6-forward primers (gcaggtatggggctagaagcactggtg and agcaggctggggactaggtaccccattcta, respectively). The cDNA clones were subjected in their entirety to double-stranded sequencing. For CYP3A4 and CYP3A5, the sequences were in complete agreement with those previously reported (Gonzalez et al., 1988a; Aoyama et al., 1989), whereas a difference of 1 base pair was found for CYP2D6, resulting in an arginine to cysteine exchange at position 140, compared with the published sequence (Gonzalez et al., 1988b). All three cDNAs were subcloned into an expression vector containing a cytomegalovirus promoter/enhancer unit from commercial vector pcDNA1 NEO (Invitrogen, Leek, The Netherlands). CHO-K1 cells were used as recipients for transfection. Stable geneticin-resistant cell clones with P450 activity were obtained and propagated in Dulbecco's modified Eagle medium containing 25 mM N-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, 1 mM sodium pyruvate, 4 mM glutamine, and 5.5 mM D-glucose. The medium also contained 100 µg/ml gentamicin, 0.4 mg/ml geneticin sulfate, and 0.4 mM L-proline and was supplemented with 10% fetal calf serum. Microsomes from cells expressing CYP3A4, CYP3A5, or CYP2D6 were prepared from CHO-K1 recombinant cells as for human liver microsomes. Isolated cells were lysed using a hand-held homogenizer, and cellular debris was removed by centrifugation at 10,000g for 20 min. The supernatant was centrifuged at 100,000g for 70 min, and the microsomal fraction was resuspended in 10 mM potassium phosphate, pH 7.4, 1 mM dithiothreitol, 20% glycerol, and stored at -80°C before use. The specific P450 contents, as measured in spectra obtained with carbon monoxide, were 70 and 134 pmol of P450/mg of microsomal protein for P4503A4 and CYP2D6, respectively. The specific CYP3A5 content was less than spectrally detectable. The corresponding catalytic activity for CYP2D6-mediated dextromethorphan O-demethylation was 80 nmol/hr/nmol of P450 (7.1 nmol/hr/mg of protein) with 5 µM dextromethorphan; the activities for CYP3A4- and CYP3A5-mediated CSA metabolism were 28 nmol/hr/nmol of P450 (2.1 nmol/hr/mg of protein) and 0.3 nmol/hr/mg of protein with 1 µM CSA, respectively.

Metabolism. Human liver microsomal incubations were performed in 500 µl of 0.1 M phosphate buffer, pH 7.4, at 37°C, except for PSC and CSA (200 µl) and theophylline (100 µl). The substrate/inhibitor was added in dimethylsulfoxide or ethanol, except for the chlorzoxazone incubations, in which chlorzoxazone was dissolved in 60 mM KOH and PSC in polyethylene glycol 400. The final vehicle concentration did not exceed 1%. Metabolism was initiated by the addition of 0.2 mM beta -NADPH and the NADPH-regenerating system, to yield final concentrations of 1 mM NADP, 5 mM isocitrate, 5 mM MgCl2, and 1 unit of isocitrate dehydrogenase. The reactions were stopped with an equal volume of cold methanol [CSA, (S)-mephenytoin, doxorubicin, and doxorubicinol], 70% perchloric acid (bufuralol), or 10% trichloroacetic acid, with cooling on dry ice. Control incubations were performed in the absence of beta -NADPH and the regenerating system or in the absence of microsomal protein.

Additional typical incubation conditions, i.e. substrate concentration, incubation time, and microsomal protein content, respectively, were as follows: PSC, 0.1-25 µM, 15 min, 50 µg; bufuralol, 5 µM, 60 min, 100 µg; [14C]chlorzoxazone, 40 µM, 20 min, 50 µg; [3H]CSA, 1 µM, 15 min, 50 µg; dextromethorphan, 5 µM, 30 min, 50 µg; [14C]doxorubicin and doxorubicinol, 40 µM, 60 min, 2 mg of S9 protein; [3H]glyburide, 5 µM, 40 min, 100 µg; (S)-[14C]mephenytoin, 100 µM, 30 min, 500 µg; [14C]phenacetin, 20 µM, 30 min, 100 µg; [3H]paclitaxel, 1-100 µM, 20 min, 50 µg; [14C]theophylline, 50 µM, 60 min, 200 µg; [14C]tolbutamide, 150 µM, 40 min, 100 µg; [14C]tropisetron and [14C]ondansetron, 50 µM, 40 min, 1 mg. For identification of metabolites by LC/MS, higher protein concentrations and longer incubation times may have been used. For all kinetic studies, the incubations were performed under linear conditions with respect to time and protein concentration. IC50 values for PSC (1 µM) metabolism were determined in the absence and presence of potential inhibitors (ranging in concentration from 0.1 to 1000 µM, depending on solubility). For the microsomes derived from the CYP3A4-, CYP3A5-, and CYP2D6-expressing cells, PSC and paclitaxel were incubated primarily as described above, except that 250 mM potassium phosphate buffer, pH 7.6, was used for CYP3A4 and CYP3A5.

HPLC Analysis. Proteins were sedimented by centrifugation at 100,000g for 10 min at room temperature, and aliquots (200-350 µl) of the supernatant were injected into the HPLC system. HPLC separations were performed with a Kontron system (Kontron Instruments, Zürich, Switzerland), a LB 507A radioactivity monitor (Berthold AG, Wildbad, Germany), and a F1000 fluorescence detector (Merck, Darmstadt, Germany). On-line radioactivity monitoring was used unless stated otherwise. All compounds and their metabolites were characterized by their retention times, by comparison of the chromatograms with those of reference compounds, and/or by LC/MS analysis. The quantitation of metabolites of radiolabeled compounds was performed by calculating the relative peak areas of parent drug and metabolite peaks; for unlabeled compounds, concentrations were calculated from standard curves.

[3H or 14C]PSC and its metabolites were chromatographed at 75°C on LC 18 columns in series (5-µm particle size, one column of 20 × 4.6 mm and two of 250 × 4.6 mm; Supelco Inc., Bellefonte, PA). The mobile phases were 10 mM NH4HCO3/methanol (9:1, pH 8.1) as solvent A and acetonitrile/methanol (9:1) as solvent B. The proportion of solvent B was 0% for the first 1 min, was then increased linearly to reach 30% at 10 min, 40% at 20 min, 70% at 120 min, and 90% at 140 min, and remained constant until 160 min. The total flow rate was 0.8 ml/min. For LC/MS, mobile phase A was 50 mM ammonium acetate/methanol (9:1), and the proportion of solvent B was 0% for the first 10 min and was then increased linearly to reach 30% at 20 min, 70% at 157 min, and 90% at 165 min. The total flow rate was 1.2 ml/min.

Bufuralol and its metabolites were analyzed at room temperature on a LC 18-DB analytical column (5-µm particle size, 250 × 4.6 mm), with a total flow rate of 1 ml/min. The mobile phases were 65% 0.2 M NaClO4, pH 4/35% acetonitrile as solvent A and acetonitrile as solvent B. The proportion of solvent B was 0% for the first 5 min, was increased linearly to 60% at 15 min, remained constant until 20 min, and was then increased to 100% at 25 min. The fluorescence detector was set to an excitation wavelength of 252 nm and an emission wavelength of 302 nm.

[14C]Doxorubicin and its metabolites were chromatographed at 40°C on a LC 18 analytical column (5-µm particle size, 250 × 4.6 mm). The mobile phases were 0.28 M sodium formate (adjusted to pH 3.55 with formic acid) as solvent A and methanol as solvent B. The proportion of solvent B was 0% for the first 2 min, was increased linearly to reach 35% at 5 min, 60% at 65 min, and 100% at 67 min, and remained constant until 75 min. The total flow rate was 1 ml/min. Doxorubicinol metabolism was monitored at 254 and 490 nm.

[14C]Chlorzoxazone and its metabolite 6-hydroxychlorzoxazone were separated at room temperature on Spheri-5 phenyl columns (5-µm particle size; Brownlee, San Jose, CA), i.e. a guard column (30 × 4.6 mm) and an analytical column (100 × 4.6 mm). The mobile phase consisted of 90% 0.018 M ammonium acetate buffer, adjusted to pH 4 with acetic acid, and 10% acetonitrile. The flow rate was 1 ml/min.

[3H]Glyburide and its metabolites were separated at 40°C on Brownlee RP-18 columns (5-µm particle size; 30 × 2.1 mm and 100 × 2.1 mm). The mobile phases were 10 mM ammonium acetate, pH 4.3, as solvent A and acetonitrile as solvent B, with a total flow rate of 0.4 ml/min. The proportion of solvent B was 0% up to 2 min, was increased linearly to reach 45% at 55 min, 80% at 62 min, 100% at 72 min, and remained constant until 75 min.

(S)-[14C]Mephenytoin and its metabolites were separated at 45°C on Brownlee RP-18 columns (5-µm particle size, 30 × 4.6 mm and 100 × 4.6 mm). Solvent A was water and solvent B was methanol, which was increased from 30% at 0 min to 100% at 10 min. The total flow rate was 1 ml/min.

[14C]Phenacetin and its metabolites were analyzed at 35°C on LC 18-DB columns (5-µm particle size; Supelco), i.e. a precolumn (20 × 4.6 mm) and an analytical column (250 × 4.6 mm). The mobile phases were 5 mM tetrabutylammonium hydrogen sulfate, 10 mM Tris base, 5 mM ethylenedinitrilotetraacetic acid, pH 7.2, as solvent A and methanol as solvent B. The proportion of solvent B was 0% for the first 5 min, was increased linearly to reach 60% at 25 min, remained constant until 35 min, and then was increased to reach 100% at 45 min. The total flow rate was 1 ml/min.

[3H]Paclitaxel and its metabolites were chromatographed at room temperature on Spheri ODS columns (5-µm particle size, 30 × 4.6 mm and 100 × 4.6 mm. The mobile phases were water as solvent A and methanol as solvent B. The proportion of solvent B was 0% for the first minute, was then increased linearly to reach 50% at 5 min, 70% at 52 min, and 100% at 54 min, and remained constant until 65 min. The total flow rate was 1 ml/min.

[14C]Tolbutamide and its metabolite 4-hydroxytolbutamide were separated at 40°C on Spheri-5 RP-18 columns (5-µm particle size; Brownlee), i.e. a guard column (30 × 2.1 mm) and an analytical column (100 × 2.1 mm). The mobile phases consisted of 10 mM ammonium acetate buffer (adjusted to pH 4.3 with acetic acid) as solvent A and acetonitrile as solvent B. The proportion of solvent B was 5% for the first 1 min and was increased linearly to reach 40% at 40 min and 100% at 45 min. The flow rate was 0.4 ml/min.

[14C]Theophylline and its metabolites were monitored after HPLC separation at room temperature on Supelcosil LC 18-DB columns (5-µm particle size, 20 × 4.6 mm and 250 × 4.6 mm). The mobile phases were 10 mM sodium acetate, pH 4.5, as solvent A and acetonitrile as solvent B, with a total flow rate of 1 ml/min. The proportion of solvent B was 5% from 0 to 9 min, was increased linearly to reach 15% at 15 min, and remained constant until 19%. In a linear increase, solvent B reached 27% at 30 min and 100% at 32 min.

[14C]Tropisetron, [14C]ondansetron, dextromethorphan, and their metabolites were analyzed as described (Fischer et al., 1994), except that dextromethorphan was analyzed with a Supelcosil LC-DP column (5-µm particle size, 50 × 4.6 mm; Supelco), with a flow rate of 1 ml/min. [3H]CSA and its metabolites were analyzed as described by (Kronbach et al., 1988).

MS Analysis. Positive-ion mass spectra were recorded with a TSQ-700 triple-stage quadrupole mass spectrometer (Finnigan MAT, San Jose, CA) equipped with an ESI interface. For PSC and its metabolites, 5 mM sodium acetate in water/methanol (8:2) was added to the column eluent at 0.3 ml/min. The total flow of 1.5 ml/min was then split ~1:1, with 0.75 ml/min going to waste and 0.75 ml/min entering the ESI interface. For paclitaxel and its metabolites, 0.2% trifluoroacetic acid in methanol was added to the column eluent at 0.3 ml/min. The total flow of 1.8 ml/min was then split ~2:1, with 1.2 ml/min going to waste and 0.6 ml/min entering the ESI interface. For doxorubicin and its metabolites, 0.2% trifluoroacetic acid in acetonitrile was added to the column eluent at 0.1 ml/min. The total flow of 1.0 ml/min was then split ~3:1, with 0.75 ml/min being used for on-line radioactivity monitoring and 0.25 ml/min entering the ESI interface. Glyburide was detected in the negative-ion mode after addition of 0.1 ml/min acetonitrile, with 20-V additional skimmer octapol voltage to induce fragmentation.

Methanol (0.05-0.1 ml/min) was used as the sheath liquid and nitrogen served as the sheath and auxiliary gas. The ESI spray voltage was 3.5 kV for PSC, 3 kV for paclitaxel, and 4.5 kV for doxorubicin and glyburide, with a capillary temperature of 250°C. Selected-ion chromatograms for PSC and its metabolites were extracted from the raw data files. The mass traces of the respective isotopes were added to enhance the signal/noise ratio.

Pgp Interactions. The paclitaxel-resistant MDA/T0.3 cells were selected from the sensitive human adenocarcinoma cell line MDA-435, which was obtained from the M. D. Anderson Cancer Center (Houston, TX) (Archinal-Mattheis et al., 1995). The drug concentration that inhibited growth by 50% was determined as described (Monks et al., 1991). Photoaffinity labeling with a [3H]cyclosporine derivative and inhibition studies of rhodamine-123 efflux from MDA/T0.3 cells were performed as described by Archinal-Mattheis et al. (1995).

Data Analysis. For the calculation of metabolic rates, mean substrate concentrations over the incubation period were used. IC50 values were determined graphically by plotting the percentage of the control activity vs. the inhibitor concentration. The Michaelis-Menten parameters KM and Vmax and SEs were determined by nonlinear curve-fitting using Fig.P software (BIOSOFT, Cambridge, UK), with the following equation:
V=V<SUB><UP>max</UP></SUB> · [<UP>S</UP>]/K<SUB>M</SUB>+[<UP>S</UP>]
For PSC, an additional linear term was added to the Michaelis-Menten equation, in case degradation was observed in control incubations, as described above.

Using a model for mixed-type inhibition, the Ki values were calculated with the following equation (Segel, 1993):
K<SUB>i</SUB>=[<UP>I</UP>]/[(K<SUB>M,<UP>i</UP></SUB><UP>/K</UP><SUB><UP>M,u</UP></SUB>)(<UP>V<SUB>max,u</SUB>/V</UP><SUB><UP>max,i</UP></SUB>)−1]
where KM,i and KM,u are the Michaelis constants and Vmax,i and Vmax,u are the maximal velocities in the presence and absence of inhibitor, respectively.

Intrinsic clearance (CLint) was calculated by dividing the maximal rate of metabolism by the Michaelis constant, according to the equation
CL<SUB><UP>int</UP></SUB>=V<SUB><UP>max</UP></SUB>/K<SUB>M</SUB>
Scaling of the intrinsic clearance to the body weight was performed by taking into account the microsomal yield per gram of liver and assuming an adult liver weight of 1.69 kg and a body weight of 70 kg. For calculations based on literature values, a yield of 15 mg of microsomal protein/g of liver was assumed.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Biotransformation Pathways. PSC was metabolized in human liver microsomal preparations to several metabolites (fig. 1). Structural information on these metabolites was obtained by LC/MS analysis with ESI (fig. 1, B-E). The chromatogram for the natriated ion of monohydroxylated metabolites (m/z 1252) (fig. 1C) closely resembled the radioactivity profile (fig. 1A) and the total-ion current between m/z 1200 and 1400 for PSC metabolites (fig. 1B), indicating that monohydroxylated products are predominantly formed under these conditions in human liver microsomal incubations. Additional structural information on the major monohydroxylated metabolite was suggested by its having a retention time (120 min) identical to that of synthetic M9, which is hydroxylated at amino acid 9 (data not shown). Additional natriated ions were detected at m/z 1268, indicating dihydroxylated products (fig. 1D), and at m/z 1222, suggesting N-demethylated products (fig. 1E).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1.   PSC metabolite profile and identification in human liver microsomes.

A, typical HPLC separation, with radioactivity monitoring, of PSC and its metabolites formed in incubations of [3H]PSC (10 µM) with human liver microsomes (500 µg/ml) for 2 hr. B-E, LC/MS analysis of these metabolites using selected-ion monitoring, i.e. total ion current between m/z 1200 and 1400 (B), monohydroxylated PSC at m/z 1252 (C), dihydroxylated PSC at m/z 1268 (D), and demethylated PSC at m/z 1222 (E).

Metabolite Interaction with Pgp. Because M9 was the major metabolite in human liver microsomes and in humans in vivo (Hauck C, personal communication), its ability to inhibit Pgp function was examined using the same human adenocarcinoma cell line (MDA/T0.3) as used previously for PSC (Archinal-Mattheis et al., 1995). These cells were selected for resistance to growth inhibition by paclitaxel (IC50 ~ 1 µM). Exposure of the cells to paclitaxel in the presence of 1 µM M9 produced growth inhibition at an 8-fold lower concentration of paclitaxel (IC50 ~ 0.12 µM) (data not shown). In comparison, PSC was much more potent and increased cellular sensitivity ~300-fold (IC50 = 2.8 nM). M9 was also less potent than PSC in inhibiting rhodamine-123 efflux from MDA/T0.3 cells (fig. 2). Complete inhibition was obtained only with 5 µM M9, compared with 1 µM PSC. A similar difference in potency was observed when the binding of the photoaffinity label to Pgp was inhibited by PSC or M9 (fig. 3). Densitometric evaluation of the labeled Pgp indicated 15-fold inhibition for PSC and 4-fold inhibition for M9, at equal (84 nM) concentrations, with respect to the [3H]cylosporine-derived label. With 10- and 100-fold excesses of PSC and M9, respectively, the binding of the photoaffinity label was completely inhibited.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of PSC and M9 on rhodamine-123 retention in MDA cells.

Sensitive MDA-435 (black histograms) and paclitaxel-resistant MDA/T0.3 (white histograms) cells were pretreated with dimethylsulfoxide (A), 0.1, 1.0, 2.5, or 5.0 µM PSC (B), or 0.1, 1.0, 2.5, or 5.0 µM M9 (C) for 90 min. After incubation, the cells were washed and incubated with rhodamine-123 for an additional 90 min. The cellular fluorescence was analyzed by flow cytometry.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Photoaffinity labeling of membrane-enriched fractions from paclitaxel-resistant (MDA/T0.3) cells.

Cells were incubated with a [3H]cyclosporine derivative photoaffinity label (84 nM) in the presence of PSC or M9 at a 0-, 1-, 10-, 100-, or 1000-fold molar excess.

Intrinsic Clearance. The rate of PSC metabolite formation was determined over the concentration range of 0.1-25 µM in two human liver microsomal preparations, i.e. GGM-002 and M8. Metabolism followed Michaelis-Menten kinetics, with similar KM values for the two livers (1.3 and 2.8 µM for GGM-002 and M8, respectively) (table 1). The Vmax values were 6.7 and 3.3 nmol/hr/mg of microsomal protein (15.2 and 11.4 nmol/hr/nmol of P450) for GGM-002 and M8, respectively. Consequently, the intrinsic clearance was ~4-fold greater for GGM-002, compared with M8, when scaled to body weight.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
Kinetic parameters for PSC metabolism

PSC was metabolized to the same metabolites as in human liver microsomes by microsomal preparations from CHO cells genetically engineered to express human CYP3A4 or CYP3A5 but not by those from cells expressing CYP2D6. The KM values for CYP3A4- and CYP3A5-containing microsomes were 1.1 and 12.6 µM, respectively, which were similar to those in liver microsomes. The maximal velocities of the reaction were 3.5 and 0.5 nmol/hr/mg of microsomal protein for CYP3A4 and CYP3A5, respectively. Consistent with these cells expressing only a single P450, the maximal velocity based on total P450 content was 4-5-fold greater for CYP3A4-expressing cells than for human liver. Because of low expression and a lack of P450 spectra, a similar comparison could not be made for cells expressing CYP3A5. However, the results suggested that both CYP3A4 and CYP3A5 are the enzymes responsible for PSC biotransformation.

Inhibition of PSC Metabolism. PSC metabolism (1 µM) was investigated in the presence of characteristic P450 isoenzyme substrates/inhibitors and in the presence of compounds likely to be coadministered with PSC during therapy (table 2). The most potent inhibitors of PSC metabolism were ketoconazole and CSA, with IC50 values of 0.1 and 0.5 µM, respectively. Ketoconazole inhibited PSC competitively, with mean Ki values of 0.01-0.04 µM for both liver preparations. Ketoconazole at 0.1 µM produced a 3-7-fold increase in the apparent KM for PSC and at 0.5 µM produced a 23-67-fold increase in the apparent KM for PSC with M8 and GGM-002 preparations, respectively, with no change in the maximal velocity. CSA was also a competitive inhibitor; its presence increased the apparent KM for PSC 4-20-fold (Ki = 2.2 µM for GGM-002). However, CSA also exhibited a noncompetitive component, because the Vmax was decreased by factors of 2 and 3 at 3.5 and 10 µM CSA, respectively. Other compounds that inhibited PSC metabolism with an IC50 of <= 20 µM included the antineoplastic agents doxorubicin, paclitaxel, and vinblastine, the antiemetic ondansetron, the antihypertensive agent nifedipine, the antibiotic erythromycin, the antidiabetic glyburide, the antiparkinsonian agent bromocriptine, the steroid ethinyl estradiol, and the antihypercholesterolemic drug lovastatin (table 2). The IC50 value for M9 of 21 µM was also approximately 10-fold higher than the KM for PSC.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 2
Inhibition of PSC metabolism

Effects of PSC on the Metabolism of Other Drugs. The potential for PSC to inhibit the metabolism of other drugs was investigated with a series of compounds that are known to be characteristic for certain P450s. Additionally, drugs that are likely to be coadministered with PSC and that exhibited inhibition of PSC metabolism were studied (table 3). PSC had no effect (at concentrations up to 20 µM) on the metabolism of phenacetin or theophylline (CYP1A2), tolbutamide (CYP2C9/10), (S)-mephenytoin (CYP2C19), or chlorzoxazone (CYP2E1). Only a small effect was observed for the CYP2D6 substrates dextromethorphan and bufuralol, with maximal inhibition of 20 and 35%, respectively, at 20 µM PSC. However, the metabolism of the CYP3A substrate CSA was inhibited by PSC with an IC50 of 6.5 µM, consistent with CYP3A being involved in the metabolism of PSC.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 3
Effects of PSC on the metabolism of characteristic CYP substrates and potentially coadministered compounds (IC50) in human liver microsomes or in S9 fractions

Of the anticancer drugs, paclitaxel has been reported to be metabolized by CYP2C8 and CYP3A4 (Cresteil et al., 1994; Rahman et al., 1994). In vitro and in humans, CYP2C8 catalyzes the formation of 6alpha -hydroxypaclitaxel, the major metabolite of paclitaxel (Harris et al., 1994a; Monsarrat et al., 1993). CYP3A4 has been suggested to be responsible for the formation of the second most important metabolite, p-hydroxyphenyl-C3'-paclitaxel (Harris et al., 1994b). p-Hydroxyphenyl-C3'-paclitaxel and 6alpha -hydroxypaclitaxel were confirmed to be M26 and M35, respectively, in human liver microsomes (fig. 4). M35 and M26 exhibited fragmentation patterns in LC/MS, as described previously (Bitsch et al., 1993). Additional metabolites monohydroxylated on the taxane ring were M29 and M32, and that monohydroxylated on the side chain was M30. The metabolite eluting at 24 min was hydroxylated on both the taxane ring and the side chain. The involvement of CYP3A4 (Cresteil et al., 1994; Harris et al., 1994b) in the formation of p-hydroxyphenyl-C3'-paclitaxel but not that of 6alpha -hydroxypaclitaxel was confirmed with microsomes from CHO cells expressing human CYP3A4. p-Hydroxyphenyl-C3'-paclitaxel was formed at rates of ~0.02 and ~0.32 nmol/hr/mg of microsomal protein (~0.29 and ~4.57 nmol/hr/nmol of P450) with 1 and 100 µM paclitaxel, respectively. The HPLC peak corresponding to p-hydroxyphenyl-C3'-paclitaxel did not increase in incubations with microsomes from CHO cells expressing either CYP3A5 or CYP2D6, compared with control incubations performed in the absence of NADPH.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Paclitaxel metabolite formation.

A typical HPLC separation, with radioactivity monitoring, of paclitaxel and its metabolites found in incubations of [3H]paclitaxel (2.5 µM) with human liver microsomes is shown. M26 and M35 were assigned as p-hydroxyphenyl-C3'-paclitaxel and 6alpha -hydroxypaclitaxel, respectively.

With human liver microsomes (GGM-002, N = 4), paclitaxel (1-100 µM) exhibited Michaelis-Menten kinetics, as described (Cresteil et al., 1994; Sonnichsen et al., 1995), with apparent KM values of 57.9 ± 43.8 µM for overall metabolism, 16.0 ± 4.5 µM for p-hydroxyphenyl-C3'-paclitaxel formation, and 34.8 ± 28.5 µM for 6alpha -hydroxypaclitaxel formation. Vmax values were 277.3 ± 185.4, 15.8 ± 3.4, and 97.9 ± 58.3 nmol/hr/mg of microsomal protein for total metabolism, p-hydroxyphenyl-C3'-paclitaxel formation, and 6alpha -hydroxypaclitaxel formation, respectively. Intrinsic clearance values for p-hydroxyphenyl-C3'-paclitaxel and 6alpha -hydroxypaclitaxel formation (1.0 ± 0.1 and 3.1 ± 1.0 ml/hr/mg of microsomal protein, respectively) represented approximately 75% of total intrinsic clearance (5.1 ± 0.9 ml/hr/mg of microsomal protein). PSC selectively inhibited p-hydroxyphenyl-C3'-paclitaxel formation. The inhibition was of a mixed type (fig. 5), with KM values approximately doubling while Vmax values were decreased by ~50% at 10 µM. The mean Ki value was 1.15 µM, similar to the KM for PSC metabolism.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   Lineweaver-Burk plots of p-hydroxyphenyl-C3'-paclitaxel formation.

Human liver microsomal incubations with ~0.7-100 µM paclitaxel (inset) were performed in the presence of 0 (), 0.5 (open circle ), 2 (triangle ), 5 (), or 10 (diamond ) µM PSC. Lines do not represent linear regression analyses but were drawn using the parameters obtained from nonlinear curve-fitting. The main panel is expanded for better visibility of the intercepts and does not show the low ~0.7 µM concentration of paclitaxel.

In contrast, PSC (20 µM) had no effect on the metabolism of doxorubicin (another antineoplastic agent) or its metabolite doxorubicinol in two different human liver S9 preparations (table 3). Doxorubicinol is the major metabolite of doxorubicin formed by the ubiquitous cytoplasmic aldoketoreductase (Takanashi and Bachur, 1976). Both doxorubicin and doxorubicinol can also be converted by microsomal P450 reductase to the corresponding 7-deoxyaglycones (Bachur and Gee, 1976). The assignment of the HPLC peaks was in agreement with the molecular ions observed during LC/MS analysis (fig. 6).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6.   Doxorubicin metabolite formation.

A typical HPLC separation, with radioactivity monitoring, of doxorubicin and its metabolites found in incubations of [14C]doxorubicin (40 µM) with a human liver S9 preparation is shown.

Similarly, PSC would not be expected to have a clinically relevant effect on the metabolism of the antiemetics tropisetron and ondansetron. These compounds were metabolized primarily to 5/6/7-hydroxytropisetron (3.9 nmol/hr/mg) and 7/8-hydroxyondansetron (1.6 nmol/hr/mg), as previously described (Fischer et al., 1994). The inhibition was small but concentration dependent, i.e. 22% and 27% for tropisetron (50 µM) and ondansetron (50 µM), respectively (table 3).

The effect of PSC on the metabolism of glyburide was investigated because of the frequent use of glyburide as an antidiabetic agent and because of its potential to inhibit the metabolism of CSA (Pichard et al., 1990, 1996) and PSC. Previously, only 4-trans-hydroxyglyburide and 3-cis-hydroxyglyburide, which are hydroxylated on the cyclohexyl moiety, had been identified and isolated from human urine and feces (Rupp et al., 1969). However, in five different human liver microsomal preparations, glyburide was metabolized to several additional metabolites (fig. 7). LC/MS analysis did not result in detectable ions for M23 (6.1 nmol/hr/mg of protein), but M44-M49 (13.6 nmol/hr/mg of protein) and M53 (6 nmol/hr/mg of protein) yielded ions of m/z 508, indicating monohydroxylation of these metabolites. The observed fragment of m/z 170 for M44-M53 and glyburide itself indicates that hydroxylation did not occur on the 5-chloro-2-methoxybenzaldehyde moiety. Cleavage of the urea amide bond resulted in fragments of m/z 367 for glyburide and peaks M44-M49 or m/z 383 for peak M53. This indicates hydroxylation on the cyclohexyl ring for peaks M44-M49, which include the previously identified 4-trans-hydroxyglyburide and 3-cis-hydroxyglyburide, and hydroxylation on the phenylethyl moiety for peak M53. Therefore, the previously identified metabolites, which are considered to be the major metabolites in humans, represented only a fraction of the peaks hydroxylated on the cyclohexyl moiety, which are ~50% of the total metabolites in human liver microsomes. In the presence of PSC (<= 20 µM), cyclohexyl hydroxylation was not inhibited (table 3). In contrast, M23 was already inhibited ~40% with 5 µM PSC, and M53 was inhibited 50% with ~3 µM PSC.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7.   Glyburide metabolite formation.

A typical HPLC separation, with radioactivity monitoring, of glyburide and its metabolites formed in incubations of [3H]glyburide (5 µM) with human liver microsomes is shown.

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The metabolism of the cyclosporine derivative PSC in human liver is very similar, with respect to pathways and interactions with P450, to that of other cyclosporines such as CSA, IMM 125, and CSG. Therefore, for the prediction and interpretation of drug interactions with PSC (when it is used in combination therapy), the extensive clinical experience gained with CSA can be used as a guideline.

PSC is metabolized by human liver microsomes to monohydroxylated, N-demethylated, and dihydroxylated products, as determined by LC/MS. These pathways have also been found in vivo (metabolites detected in human plasma and urine) for PSC (Hauck C, personal communication) and are analogous for the other cyclosporines (Kronbach et al., 1988; Maurer, 1985; Vickers et al., 1995; Mangold et al., 1994). The apparent KM for PSC of the human liver microsomal enzymes is similar to those reported for CSA (1.7-10 µM) (Fischer et al., 1994; Pichard et al., 1990, 1996; Maurer, 1985), for IMM 125 (5.1 µM) (Vickers et al., 1995), and for CSG (5-9 µM) (Pichard et al., 1996). Furthermore, the intrinsic clearance of PSC determined with human liver microsomes (9-36 ml/min/kg of body weight) is within the range estimated for the other cyclosporines from literature values, as follows: CSA, 4-180 ml/min/kg of body weight (Fischer et al., 1994; Maurer, 1985); IMM 125, 4 ml/min/kg of body weight (Vickers et al., 1995); CSG, ~9 ml/min/kg of body weight (Pichard et al., 1996).

The metabolism of PSC, like that of the other cyclosporines, was CYP3A dependent. PSC biotransformation was measurable only in cell lines expressing CYP3A4 and CYP3A5 and not CYP2D6. In addition, compounds that are known to inhibit CYP3A also inhibited PSC metabolism. Furthermore, the inhibition was mainly competitive for the CYP3A substrates CSA and ketoconazole. The potencies for inhibition of PSC metabolism by the compounds tested (table 2) compare well with the known potencies of these compounds to inhibit CYP3A. For example, reported Ki values for CYP3A substrate (CSA) inhibition are 0.7, 8, and 10 µM for ketoconazole, bromocryptine, and nifedipine, respectively (Pichard et al., 1990), and 31 µM for ondansetron (Fischer et al., 1994). In contrast, compounds such as phenacetin, quinidine, dextromethorphan, fluvastatin, and tolbutamide, which are known not to markedly inhibit CYP3A, had little effect on PSC metabolism. The selective inhibition of CYP3A-mediated reactions such as CSA metabolism and p-hydroxyphenyl-C3'-paclitaxel formation by PSC also is consistent with CYP3A being the major enzyme in PSC biotransformation. The observed trend toward CYP2D6 inhibition, although consistent for all investigated CYP2D6 substrates, i.e. dextromethorphan, bufuralol, tropisetron, and ondansetron (Fischer et al., 1994; Dayer et al., 1989; Yamazaki et al., 1994; Dixon et al., 1995), would be too small to be of any clinical relevance. Overall, PSC appears to be a specific inhibitor of CYP3A.

PSC inhibited the metabolism of glyburide, a potentially coadministered antidiabetic agent, to a limited extent. Only pathways that had not been previously reported, including hydroxylation at the phenylethyl moiety, were inhibited, indicating that these pathways must involve CYP3A. In contrast, the lack of inhibition by PSC of the formation of cyclohexyl-hydroxylated metabolites, such as 4-trans-hydroxyglyburide and 3-cis-hydroxyglyburide, indicates the involvement of enzymes other than CYP3A in these pathways. The limited involvement of CYP3A in glyburide metabolic clearance could explain why erythromycin, a CYP3A inhibitor, did not affect glyburide clearance in a clinical trial (Fleishaker and Phillips, 1991). Because PSC is also a selective CYP3A inhibitor, no clinically significant reduction in glyburide clearance can be expected when PSC is coadministered. Glyburide should also not influence PSC concentrations, because the IC50 toward PSC metabolism is >1 order of magnitude higher than its maximal plasma concentrations at a relatively high 20-mg dose (Coppack et al., 1990).

For the coadministration of PSC and paclitaxel, a result similar to that observed with CSA, which also selectively inhibits p-hydroxyphenyl-C3'-paclitaxel formation in human liver in vitro (Harris et al., 1994b; Kumar et al., 1994), would be expected. Clinically, CSA increases paclitaxel exposure; indeed, a similar 50% dose reduction of paclitaxel was required when PSC was used instead of CSA (Fisher et al., 1994a,b). Inhibition of paclitaxel elimination by Pgp and/or inhibition of p-hydroxyphenyl-C3'-paclitaxel formation could contribute to the observed increase in plasma concentrations. However, it appears unlikely that either mechanism by itself can explain the extent of the observed clinical effect. Paclitaxel is eliminated predominantly by metabolic clearance via the bile, and combined urinary and biliary excretion of unchanged paclitaxel was only ~10% of the dose (Walle et al., 1995). Also, the major metabolite in 75% of human liver microsomal preparations appears to be 6alpha -hydroxypaclitaxel, whereas p-hydroxyphenyl-C3'-paclitaxel was the major metabolite in ~25% of human liver microsomal preparations (Sonnichsen et al., 1995). Paclitaxel did not influence CSA or PSC exposure in humans, as expected based on the low plasma concentrations, compared with the paclitaxel Ki value for CYP3A inhibition (Fisher et al., 1994; Smith H, personal communication).

The clinically observed increases in doxorubicin exposure and reduced clearance in the presence of PSC (Erlichman et al., 1993; Bartlett et al., 1994) cannot be explained by a reduction in doxorubicin metabolism by PSC. Doxorubicin is not metabolized by CYP3A, and PSC had no effect on the formation of the major metabolite doxorubicinol by the ubiquitous aldoketoreductase or on the removal of the daunosamine sugar by the microsomal P450 reductase. Instead, a major portion (50%) of doxorubicin is excreted unchanged in the bile (Riggs et al., 1977), and changes in tissue distribution and reduced transport into the bile (Colombo et al., 1994; Speeg and Maldonado, 1994) could explain the increased exposure and reduced clearance observed in the clinical trials. Although doxorubicin was also found to inhibit PSC metabolism in vitro, with an IC50 value of 20 µM, the therapeutic range at steady state is at least 100-fold lower (Meyer, 1994), and the presence of doxorubicin should not lead to relevant changes in the metabolic clearance of PSC.

Etoposide is approximately equally excreted in urine and bile (Lum et al., 1992). Approximately 20-35% of the etoposide dose is excreted unchanged in the urine and ~2% in bile. The remainder is metabolized, and CYP3A is the main enzyme catalyzing etoposide O-demethylation (Relling et al., 1994). Typical therapeutic concentrations of ~17 µM (Lum et al., 1992) are approximately 5-fold below the KM for CYP3A (Relling et al., 1992) and 10-fold below the IC50 for PSC metabolism. Etoposide should therefore not be able to influence the metabolic clearance of PSC. Conversely, PSC at typical concentrations of 4 µM could inhibit the O-demethylation of etoposide. The observed increases in the plasma concentrations of etoposide when it is combined with PSC may be the result of a combination of inhibition of active secretion by Pgp and inhibition of metabolism (Boote et al., 1996). Because the pharmacokinetics of other epipodophyllotoxins, such as teniposide, are not significantly different from those of etoposide, similar interactions with PSC would be expected.

Vinca alkaloids are also metabolized primarily by CYP3A4, making their elimination susceptible to inhibition by PSC (Zhou et al., 1993; Zhou-Pan et al., 1993). However, little is known regarding whether Vinca alkaloids are excreted mainly unchanged or as metabolites. Therefore, it is difficult to determine the exact mechanism for the increases in plasma concentrations seen in clinical trials when PSC is coadministered with Vinca alkaloids.

For the antiemetics tropisetron and ondansetron, metabolic drug interactions with PSC are not expected. Both are only partially metabolized by CYP3A, and their therapeutic plasma concentrations are 2-3 orders of magnitude below the concentrations at which they inhibit PSC metabolism in vitro (Fischer et al., 1994; Dixon et al., 1995).

In summary, the evidence indicates that PSC is metabolized in a manner analogous to that of other cyclosporines, by hydroxylation and N-demethylation to less active metabolites. As with the other cyclosporines, metabolism is mediated by CYP3A. The knowledge of the enzymes involved in the biotransformation of PSC and the proof of similarity to other cyclosporines will allow physicians to use the clinical experience gained with CSA for better prediction and interpretation of drug interactions with PSC.

    Acknowledgments

We thank Drs. H. Andres, T. Moenius, and R. Voges for synthesis of the radiolabeled compounds, Dr. R. Wenger for synthesis of the main PSC metabolite, R. Nufer for LC/MS operation, and P. Kwon and N. Kohn for technical assistance.

    Footnotes

Received November 21, 1997; accepted March 31, 1998.

Send reprint requests to: Dr. Volker Fischer, Novartis Pharmaceuticals Corp., 59 Route 10, East Hanover, NJ 07936.

    Abbreviations

Abbreviations used are: MDR, multidrug resistance; Pgp, P-glycoprotein; CHO, Chinese hamster ovary; CSA, cyclosporine A; CSG, cyclosporine G; CYP or P450, cytochrome P450; ESI, electrospray ionization; PSC, valspodar (PSC 833).

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References


0090-9556/98/2608-0802-0811$02.00/0
DRUG METABOLISM AND DISPOSITION
Copyright © 1998 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
Cancer Res.Home page
C. A. Burkhart, F. Watt, J. Murray, M. Pajic, A. Prokvolit, C. Xue, C. Flemming, J. Smith, A. Purmal, N. Isachenko, et al.
Small-Molecule Multidrug Resistance-Associated Protein 1 Inhibitor Reversan Increases the Therapeutic Index of Chemotherapy in Mouse Models of Neuroblastoma
Cancer Res., August 15, 2009; 69(16): 6573 - 6580.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
J. P. Bankstahl, C. Kuntner, A. Abrahim, R. Karch, J. Stanek, T. Wanek, W. Wadsak, K. Kletter, M. Muller, W. Loscher, et al.
Tariquidar-Induced P-Glycoprotein Inhibition at the Rat Blood-Brain Barrier Studied with (R)-11C-Verapamil and PET
J. Nucl. Med., August 1, 2008; 49(8): 1328 - 1335.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
D. J. McConn II, Y. S. Lin, K. Allen, K. L. Kunze, and K. E. Thummel
DIFFERENCES IN THE INHIBITION OF CYTOCHROMES P450 3A4 AND 3A5 BY METABOLITE-INHIBITOR COMPLEX-FORMING DRUGS
Drug Metab. Dispos., October 1, 2004; 32(10): 1083 - 1091.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. E. Bates, S. Bakke, M. Kang, R. W. Robey, S. Zhai, P. Thambi, C. C. Chen, S. Patil, T. Smith, S. M. Steinberg, et al.
A Phase I/II Study of Infusional Vinblastine with the P-Glycoprotein Antagonist Valspodar (PSC 833) in Renal Cell Carcinoma
Clin. Cancer Res., July 15, 2004; 10(14): 4724 - 4733.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
A. E. M. Vickers, M. Zollinger, R. Dannecker, R. Tynes, F. Heitz, and V. Fischer
In Vitro Metabolism of Tegaserod in Human Liver and Intestine: Assessment of Drug Interactions
Drug Metab. Dispos., October 1, 2001; 29(10): 1269 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. H. Kang, W. D. Figg, Y. Ando, M. V. Blagosklonny, D. Liewehr, T. Fojo, and S. E. Bates
The P-Glycoprotein Antagonist PSC 833 Increases the Plasma Concentrations of 6{{alpha}}-Hydroxypaclitaxel, a Major Metabolite of Paclitaxel
Clin. Cancer Res., June 1, 2001; 7(6): 1610 - 1617.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Patnaik, E. Warner, M. Michael, M. J. Egorin, M. J. Moore, L. L. Siu, P. M. Fracasso, S. Rivkin, I. Kerr, M. Litchman, et al.
Phase I Dose-Finding and Pharmacokinetic Study of Paclitaxel and Carboplatin With Oral Valspodar in Patients With Advanced Solid Tumors
J. Clin. Oncol., November 1, 2000; 18(21): 3677 - 3689.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
E. F. Choo, B. Leake, C. Wandel, H. Imamura, A. J. J. Wood, G. R. Wilkinson, and R. B. Kim
Pharmacological Inhibition of P-glycoprotein Transport Enhances the Distribution of HIV-1 Protease Inhibitors into Brain and Testes
Drug Metab. Dispos., June 1, 2000; 28(6): 655 - 660.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. J. Newman, J. C. Rodarte, K. D. Benbatoul, S. J. Romano, C. Zhang, S. Krane, E. J. Moran, R. T. Uyeda, R. Dixon, E. S. Guns, et al.
Discovery and Characterization of OC144-093, a Novel Inhibitor of P-Glycoprotein-mediated Multidrug Resistance
Cancer Res., June 1, 2000; 60(11): 2964 - 2972.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
A. E. M. Vickers, J. R. Sinclair, M. Zollinger, F. Heitz, U. Glänzel, L. Johanson, and V. Fischer
Multiple Cytochrome P-450s Involved in the Metabolism of Terbinafine Suggest a Limited Potential for Drug-Drug Interactions
Drug Metab. Dispos., September 1, 1999; 27(9): 1029 - 1038.
[Abstract] [Full Text]


Home page
Drug Metab. Dispos.Home page
J.-G. Shin, N. Soukhova, and D. A. Flockhart
Effect of Antipsychotic Drugs on Human Liver Cytochrome P-450 (CYP) Isoforms In Vitro: Preferential Inhibition of CYP2D6
Drug Metab. Dispos., September 1, 1999; 27(9): 1078 - 1084.
[Abstract] [Full Text]


Home page
Drug Metab. Dispos.Home page
V. Fischer, L. Johanson, F. Heitz, R. Tullman, E. Graham, J.-P. Baldeck, and W. T. Robinson
The 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Inhibitor Fluvastatin: Effect on Human Cytochrome P-450 and Implications for Metabolic Drug Interactions
Drug Metab. Dispos., March 1, 1999; 27(3): 410 - 416.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fischer, V.
Right arrow Articles by Vickers, A. E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fischer, V.
Right arrow Articles by Vickers, A. E. M.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition