![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 28, Issue 1, 96-101, January 2000
-Hydroxylase Inhibitor
Metyrapone on Human Hepatic Cytochrome P-450 Expression: Induction of
Cytochrome P-450 3A4
Department of Toxicology, St Bartholomew's and the Royal London School of Medicine and Dentistry, London, United Kingdom (J.L.H., A.J.P., M.C.W.); Institut National de la Santé et de la Recherche Médicale U128, Centre National de la Recherche Scientifique, Montpellier, France (P.M.); and University Medicine, Southampton General Hospital, Southampton, United Kingdom (M.C.W.)
 |
Abstract |
|---|
 Top
 Abstract
 Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The drug metyrapone in the presence of glucocorticoid has been
shown to induce the expression of rat hepatic cytochrome P-450 (CYP)
1A1 mRNA in vivo and in vitro through disruption of endogenous CYP1A1
regulator homeostasis and without either compound's binding to the
aryl hydrocarbon receptor. Addition of metyrapone to human liver cancer
cell cultures, with or without dexamethasone, did not induce CYP1A1
mRNA, in contrast to the aryl hydrocarbon receptor ligand
-naphthoflavone. Addition of metyrapone to primary cultures of human
hepatocytes also failed to induce detectable levels of CYP1A1 mRNA or
CYP1A protein in two separate preparations, whereas the treatment with
2,3,7,8-tetrachlorodibenzo-
-dioxin or omeprazole induced detectable
levels of CYP1A1 mRNA in one preparation and CYP1A protein in both
preparations. Addition of metyrapone to human hepatocyte cultures
resulted in the induction of CYP3A4 expression. The pregnane X receptor
(PXR), which has recently been shown to mediate the transcriptional
induction of CYP3A4 expression in response to rifampicin, was activated
by metyrapone in CV-1 cells transiently cotransfected with an
expression vector encoding the human PXR and a reporter construct
containing the everted repeat sequence that confers CYP3A4 induction
responsiveness to inducers within its promoter. Metyrapone activated
the human PXR at concentrations that also resulted in the induction of
CYP3A4 in human cultured hepatocytes. Metyrapone treatment is therefore unlikely to result in the induction of CYP1A1 but may induce the expression of CYP3A4 in humans.
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Cytochrome
P-450s (CYP)2 are
heme-thiolate proteins that play a prominent role in the metabolism of
both endogenous and exogenous compounds (Nelson et al., 1996
) and are
widely acknowledged to be primary determinants in the toxicity and/or
carcinogenicity of exogenous compounds such as drugs (Paine, 1995).
Metyrapone [2-methyl-1,2-bis-(3-pyridyl)-1-propanone] is
used clinically to block adrenal CYP11 hydroxylase activity
(CYP11B1), which functions to convert deoxycortisol to cortisol
(Dominiguez and Samuels, 1963). Metyrapone administration is used as a
treatment for Cushing's syndrome (Verhelst et al., 1991); as a
treatment for depression (Mitchell and O'Keane, 1998); to prevent
tumor metastasis after surgery (Deguchi et al., 1998); to test for
hypothalamic-pituitary-adrenal axis function (Fiad et al., 1994); and
may be of clinical value in reducing brain damage as a result of
hypoxia-ischemia (Krugers et al., 1998).
Work by this group has demonstrated that metyrapone is an inducer of
rat hepatic CYP1A1 and CYP3A gene expression (Wright et al.,
1994, 1996; Harvey et al., 1998). CYP1A1 is prominent in the metabolism
and activation of many polyaromatic hydrocarbons to genotoxic
intermediates (Shimada et al., 1992), and its polymorphic inducibility
in humans has been shown to be linked to lung cancer (Kawajiri et al.,
1995). CYP1A1 has been shown to be inducible in human gut (Buchthal et
al., 1995), and therefore the oral administration of metyrapone for
long periods may increase the risk of developing cancer in the
alimentary canal in particular, as well as in other tissues. The CYP3A
subfamily of CYPs are expressed constitutively at a high level
in human gut and liver and metabolize a broad range of structurally
diverse drugs and xenobiotics (Wrighton and Stevens, 1992).
Administration of metyrapone may therefore affect the metabolism of
other drugs.
Human liver cell culture is a convenient model system to examine
the ability of xenobiotics to modulate drug-metabolizing enzyme
expression (Curi-Pedrosa et al., 1994). In view of the effects of
metyrapone on rat hepatic CYP1A and CYP3A expression, the effect of
metyrapone on human CYP1A1 and CYP3A4 expression has been examined.
| |
Materials and Methods |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The human liver cancer cell lines HepG2 and Hep3B and the monkey
kidney fibroblast CV-1 cell line were purchased from the European
Collection of Animal Cell Cultures (Salisbury, UK). A plasmid
containing the human glyceraldehyde phosphate dehydrogenase (Gra-PDH)
cDNA was obtained from Dr. P. Fort (Fort et al., 1985). Oligonucleotides were synthesized by Amersham Pharmacia Biotech (Amersham, Bucks, UK). [
-32P]dCTP and
[
-32P]ATP (>3000 Ci/mol) were purchased
from Amersham Pharmacia Biotech. Goat anti-rat CYP1A anti-sera
was purchased from Daiichi Pure Chemicals (Tokyo, Japan), and
microsomes from human B lymphoblastoid cells stably expressing human
CYP1A1 were purchased from Gentest Corp. (Woburn, MA). Antibodies
raised to C-terminal peptide sequences present in CYP3A4/CYP3A7 and
CYP3A5 were provided by Dr. Rob Edwards (Royal Postgraduate Medical
School, London, UK) (Hakkola et al., 1996). Metyrapone and
rifampicin were purchased from Sigma Chemical Co. (Poole, Dorset,
UK). 2,3,7,8-tetrachlorodibenzo--dioxin (TCDD) and omeprazole
were generous gifts from Dr. A. Smith (University of Leicester,
Leicester, UK) and Astra (Molndal, Sweden), respectively. The
minimal dioxin-responsive reporter vector pTX1X1/inv was provided by
Dr. L. Poellinger (Berghard et al., 1993); the pBLh1A1CAT reporter plasmid was constructed by polymerase chain reaction amplification of
the human CYP1A1 5'-flanking sequence (
1560 to +88, relative to the
transcription start site), which was then fused to the promoter-enhancerless pBLcat vector (Luckow and Schutz, 1987), as
previously outlined (Daujat et al., 1996); and the pSV-Gal plasmid was
purchased from Promega (Southampton, UK). The pSG5-hPXR
ATG and
chloramphenicol acetyl transferase (CAT) reporter construct (ER6)3-tk-CAT were supplied by Dr. S. Kliewer (Glaxo-Wellcome R & D,
Research Triangle Park, NC) (Lehmann et al., 1998). All other chemicals
were of the highest purity available from local commercial sources.
Cell Culture. HepG2 and Hep3B and cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% v/v heat-inactivated fetal calf serum (Life Technologies, Inc., Rockville, MD), 1% v/v nonessential amino acids (Life Technologies, Inc.), 0.3% amphotericin B (Fungizone), and 1% v/v penicillin-streptomycin. CV-1 cells were cultured in DMEM supplemented with 10% fetal calf serum (Life Technologies, Inc.) and 1% penicillin-streptomycin. The cells were cultured in a humidified atmosphere of 5% CO2/95% air at 37°C and routinely passaged by trypsinization when they were approximately 90% confluent.
Human hepatocytes were isolated from discarded surgical material by collagenase perfusion as described previously (Diaz et al., 1990),
after hepatectomies from patients with secondary hepatic tumors. The
use of this tissue in these studies was approved by the French Ethics
Committee. Hepatocyte culture FT122 was prepared from liver taken from
a 61-year-old female with a primary hepatocellular carcinoma;
hepatocyte culture FT123 was prepared from liver taken from a
66-year-old male subjected to a left hepatectomy; and hepatocyte culture HTL98 was prepared from liver taken from a 65-year-old male
after metastasis of a colon primary tumor. Hepatocytes routinely had a
viability of 90%, as determined by trypan blue exclusion, and were
cultured at a density of 10 million cells/7 ml of culture medium on
collagen-coated (95-98% type I), 100-mm diameter plates (ICN
Pharmaceuticals, Paisley, Scotland). Hepatocytes were cultured for the first 4 h in 1:1 (v/v) Ham's F12/Williams' medium E
supplemented with 5% v/v fetal calf serum, 0.25% w/v sodium
bicarbonate, 15 mM HEPES, 500 U/ml penicillin, 500 µg/ml
streptomycin, 56.5 µM ethanolamine, 100 µg/ml transferrin, 0.6 µg/ml insulin, 100 nM dexamethasone, 10 nM glucagon, 7.18 µM
linoleic acid linked to 0.08% w/v fatty acid-free BSA, 7 mM glucose,
0.4 mM sodium pyruvate, 100 µM ascorbic acid, and trace elements
(Hutchings and Sato, 1978) in a humidified atmosphere of 5%
CO2/95% air at 37°C. After 4 h, the
culture medium was replaced without fetal calf serum, and hepatocytes
were cultured serum-free thereafter with medium changes/inducer
treatment as indicated every 24 h. Inducers were added to culture
medium from 1000-fold molar concentrated ethanol-solvated stocks;
control cells received ethanol alone (0.1% v/v).
Northern Blotting.
Total RNA samples were denatured and size fractionated through a
denaturing formaldehyde/agarose gel (1.3% w/v agarose gel) and
transferred from the gel to a nylon membrane (Hybond-N, Amersham, UK)
as described previously (Wright et al., 1996). The CYP1A1 and Gra-PDH
cDNA probes were labeled by random priming and oligonucleotides designed to hybridize to 28S rRNA (5'-AACGATCAGAGTAGTGGTATTTCACC-3') and CYP3A7 mRNA (5'-AATCTACTTCCCCAGCACTGA-3') was 5'-end labeled with
[-32P]ATP and polynucleotide kinase using
kits from Promega. Radiolabeled probes were hybridized to immobilized
RNA in Quickhyb solution (Stratagene, Southampton, UK) under the
conditions recommended by the manufacturers. After washing, membranes
were wrapped in Saran wrap and exposed to autoradiographic film at
70°C.
Western Blotting.
Hepatocytes were washed with PBS, scraped in 1 ml of PBS, and
centrifuged at 500g for 3 min to pellet the cells. The
supernatant was removed, and the pellet was resuspended in 20 mM
Tris-HCl buffer, pH 7.5, containing 250 mM sucrose, turrax homogenized, and an aliquot of the cell extract homogenate was removed for protein
analysis (Lowry et al., 1951) using BSA as standard. Cell extracts were
examined for CYP expression by Western blotting after separation of
proteins on 9% w/v separating/4% stacking discontinuous
SDS-polyacrylamide gels under reducing conditions. Proteins were
transferred to nitrocellulose (Schleicher & Schuell, Anderman & Co.,
Kingston, Surrey, UK), and nonspecific binding sites were blocked by
incubation with 3% BSA in 20 mM Tris-HCl-200 mM NaCl buffer, pH 7.4 (TBS) containing 0.3% (v/v) Tween 20 overnight at 4°C. Membranes
were incubated in TBS containing 0.05% Tween 20 (TBS-T) with 0.3% w/v
BSA with either goat anti-rat CYP1A, which cross-reacts with human
CYP1A; sheep anti-baboon CYP3A, which cross reacts with human CYP3A
(Dalet-Beluche et al., 1992); rabbit anti-TVSGA, an antibody raised to
the C terminus peptide sequence present in CYP3A4 and CYP3A7 (Hakkola
et al., 1996); or rabbit anti-TLSGE, an antibody raised to the C
terminus peptide sequence of CYP3A5 (Hakkola et al., 1996). Membranes
were then washed in TBS-T, incubated with the appropriate horseradish
peroxidase-conjugated anti-IgG antibody in TBS-T with 0.3% w/v
BSA, and extensively washed with TBS-T. Immunoreactive proteins were
detected by exposing X-ray film to chemiluminescence generated from a
reaction mediated by the antibody-conjugated horseradish peroxidase,
using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech).
Transient Transfection.
Subconfluent HepG2 cells were trypsinized, resuspended in serum-free
medium, and transfected with plasmid DNA using the cationic liposome
3b[N-(N'N'-dimethylaminoethane)-carbarmoyl
cholesterol] essentially as described previously (Daujat et al.,
1996). A liposome/plasmid DNA complex ratio of 25 µg of liposome/10
µg of plasmid DNA was added per 1 × 106
cells, which were then seeded at 1 × 106
cells/60-mm diameter culture plate. After a 6-h incubation at 37°C in
a humidified atmosphere of 5% CO2/95% air, the medium was
changed to contain serum. After an additional 18 h of culture, the
cells were treated with inducers for another 24 h. At the end of
the incubation, the culture medium was removed and the cells were
washed with 2 ml of PBS, and cell extracts were prepared for analysis
of luciferase activities using a kit purchased from Promega or
chloramphenicol acetyl transferase activities as described previously
(Daujat et al., 1996).
ATG and a CAT reporter construct (ER6)3-tk-CAT
(Lehmann et al., 1998). The pSG5-hPXRATG plasmid consists of the
pSG5 Stratagene expression vector containing the cDNA sequence encoding
1 to 434 amino acids of the human PXR inserted at
EcoRI/BamHI. The (ER6)3-tk-CAT plasmid consists
of three copies of the CYP3A4 everted repeat (ER6) site
(ATATGAACTCAAAGGAGGTCAGTG) inserted at the
BamHI site of pBLCAT2. Before transfection, CV-1 cells were
trypsinized and cultured in DMEM supplemented with 10% (v/v)
charcoal/dextran stripped fetal calf serum for 2 to 3 days
before transfection. Cells were transfected using Effectene (Qiagen)
essentially as recommended by the manufacturers. After 24 h, cells
were treated with inducers from stocks prepared in dimethyl sulfoxide
at a concentration 1000-fold of that required in the medium. Controls
were treated with 0.1% (v/v) dimethyl sulfoxide. After an additional
24 h, cells were harvested, extracts prepared by freeze-thaw, and
normalized CAT activities determined as described (Daujat et al.,
1996). Luciferase and CAT activities were normalized for cytosolic
protein and -galactosidase activities. -galactosidase activities
were determined by chemiluminescence using the Galacto-Light kit
(Tropix, Inc., Bedford, MA).
| |
Results |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Effect of Metyrapone on CYP1A1 Expression in Human Liver Cancer
Cells and Human Hepatocytes.
Figure 1 shows that metyrapone did not
induce detectable expression of CYP1A1 mRNA in the hepatoblastoma HepG2
(Fig. 1A) and hepatocellular Hep3B (Fig. 1B) cell lines. The addition
of the glucocorticoid dexamethasone alone or in combination with
metyrapone also did not result in the induction of detectable levels of
CYP1A1 mRNA. In contrast, the aryl hydrocarbon receptor (AhR) agonist -naphthoflavone (-NF) (Morville et al., 1983; Harvey et al., 1998) markedly induced CYP1A1 mRNA expression in both cell lines (Fig.
1). Fig. 1 also indicates that addition of dexamethasone to
-NF-treated cells did not further increase the levels of induction of CYP1A1 mRNA induced by -NF.
|
). Despite the presence of dexamethasone in the basal culture
medium for human hepatocytes (at 100 nM), addition of metyrapone did
not result in the detectable induction of CYP1A1 mRNA in human
hepatocyte FT122 and FT123 cultures (Fig. 2A). In rat hepatocyte
culture, metyrapone-dependent induction of CYP1A1 requires the presence of a glucocorticoid at levels that activate the glucocorticoid receptor
(Wright et al., 1996). However, the protein synthesis inhibitor
cycloheximide may substitute for the permissive role of dexamethasone
with respect to metyrapone-dependent CYP1A1 mRNA induction (Harvey et
al., 1998). Both TCDD-dependent and omeprazole-dependent induction of
CYP1A1 mRNA in preparation FT123 was further increased by the addition
of the protein synthesis inhibitor cycloheximide (Fig. 2A). However,
the presence of cycloheximide in culture medium containing metyrapone
had no effect on the refractivity of FT122 and FT123 hepatocytes to
CYP1A1 mRNA induction by metyrapone (Fig. 2A).
|
|
). The levels of CYP1A fall to
undetectable levels in culture FT122 in control and
metyrapone-containing cultures, whereas TCDD-treated hepatocytes had
increased levels of CYP1A protein (Fig. 2B). In culture FT123, CYP1A
levels decrease in control cells but remain detectable. Addition of
metyrapone resulted in higher levels of CYP1A protein than were
detectable in control cultures. However, the levels remained less than
those present in the isolated cells from which the culture was made. In
contrast, both TCDD and omeprazole induced CYP1A to greater levels than
were present in the isolated cells (Fig. 2B).
Effect of Metyrapone and Dexamethasone on Xenobiotic Response Element (XRE) and Human CYP1A1 5'-Flanking Region-Driven Reporter Gene Expression in Transiently Transfected HepG2 Cells. Table 1 shows that pTX1X/Inv reporter gene expression was not induced in response to metyrapone or dexamethasone treatment and was weakly induced, 1.5-fold, when these compounds were coadministered. Addition of the AhR agonist TCDD markedly increased pTX1X/Inv reporter gene expression, 8.6-fold (Table 1). Coaddition of dexamethasone with TCDD did not significantly affect the levels of pTX1X/Inv reporter gene expression (Table 1). pBLh1A1CAT reporter gene expression also was not induced in response to metyrapone or dexamethasone treatment but was significantly induced, 2.1-fold, when these compounds were coadministered (Table 1). Addition of the AhR agonist TCDD increased pBLh1A1CAT reporter gene expression 4.9-fold, although, in contrast to pTX1X/Inv, coaddition of dexamethasone with TCDD further increases the levels of pBLh1A1CAT reporter gene expression (Table 1).
|
Effect of Metyrapone on CYP3A Expression in HepG2 and Human
Hepatocyte Culture.
Metyrapone has been demonstrated to be a transcriptional inducer of the
rat CYP3A1/CYP3A23 genes (Wright et al., 1996). Figure 3 indicates that
CYP3A proteins were readily inducible in human hepatocytes from
preparations FT122 and HTL98 in response to the addition of the potent
human CYP3A inducer rifampicin (Pichard et al., 1990) and metyrapone to
culture media. The response is also observed when extracts are probed
with an antibody that immunoreacts with the major expressed CYP3A4 and
the fetal expressed CYP3A7. CYP3A7 is polymorphically, lowly expressed
in adult liver, and expression of the protein is not induced in
response to rifampicin treatment in adult human liver (Greuet et al.,
1996). This suggests that the protein induced in response to metyrapone
treatment in human liver cells is CYP3A4. The HepG2 cell line has been
shown to induce the expression of CYP3A7 mRNA in response to rifampicin but does not express CYP3A4 and CYP3A5 mRNAs (Schuetz et al., 1993). In
our hands, CYP3A7 mRNA levels in HepG2 cells were at the limit of
detection by Northern blotting, and treatment daily for 3 days with
metyrapone did not result in an induction of CYP3A7 mRNA levels (data
not shown). This observation therefore supports the suggestion that
metyrapone induces the expression of CYP3A4 but not CYP3A7 proteins.
|
).
|
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Data presented in this article indicate that metyrapone is an
inducer of CYP3A4 but not of CYP1A1 gene expression in human liver
cells. Induction of CYP3A gene expression by metyrapone is therefore
observed in both rats and humans. The absence of an induction of CYP1A1
mRNA in human liver cancer cell lines and primary cultured hepatocytes
in response to the coaddition of metyrapone and dexamethasone contrasts
with the induction response observed in livers from rats and in primary
rat hepatocyte cultures cotreated with these compounds (Harvey et al.,
1998).
CYP1A1 expression is induced through specific interaction of inducers
with the AhR, a basic helix-loop-helix protein component of a
transcription factor complex that associates with specific DNA
sequences known as XRE (Jones and Whitlock, 1990), upstream of the
CYP1A1 gene. The XREs have been shown to confer responsiveness to
AhR-dependent induction in mice, rats, and humans and to result in
increased transcription of the CYP1A1 gene (Denison et al., 1988;
Fischer et al., 1990; Hankinson, 1995). Metyrapone and all of its known
metabolites do not possess the structural qualities of typical AhR
ligands (D. Lewis, personal communication), and metyrapone does not
compete with TCDD for binding to the rat AhR (Harvey et al., 1998). Our
previous work with rats suggests that metyrapone affects the levels of
an as yet unidentified endogenous ligand for the AhR. Despite the
absence of genomic CYP1A1 gene induction in response to metyrapone and
glucocorticoid in human liver, we found that it is possible to
stimulate reporter gene expression regulated by the CYP1A1 gene
promoter in response to metyrapone and glucocorticoid in transient
transfection assays. The greater-fold increase in reporter gene
expression in cells transfected with pBLh1A1CAT compared with pTX1X/Inv
supports the contention that cis-acting elements outside the
XRE, such as derepression by a glucocorticoid receptor-modulated
negative-acting factor, are important for induction by an endogenous
regulator as observed in rats (Harvey et al., 1998). Experiments in
rats suggest that metyrapone-dependent induction of CYP1A1 mRNA is
dependent on the amino acid tryptophan (Harvey et al., 1998), a
photoactivated product of which has been shown to ligand the AhR (Wei
et al., 1998). Tryptophan was also present in the culture media used in these studies, and therefore induction of reporter gene expression in
transfection assays may be associated with generation of a tryptophan-derived regulator. However, the absence of any
detectable CYP1A1 mRNA induction in liver cancer cell lines and in
primary hepatocyte cultures suggest that the cis elements
present in the 5' flanking region of the human liver CYP1A1 gene are
not significantly functional to result in a detectable induction of
CYP1A1 mRNA by metyrapone. The reason(s) for this species difference in
CYP1A1 induction between rats and humans is presently unknown, but it may be postulated that proteins required for derepression by a glucocorticoid receptor-modulated negative-acting factor cannot interact with their DNA binding site in human DNA but can in rat DNA
(or naked transfected DNA).
The expression of CYP3A4 may be modulated by many drugs through
activation of a recently identified orphan nuclear receptor entitled
the PXR (Blumberg et al., 1998; Lehmann et al., 1998). Transcriptional
induction of the CYP3A4 gene in response to inducers, including
metyrapone, has been mapped to the ER6 DNA sequence present in the 5'
upstream region of the CYP3A4 gene (Barwick et al., 1996; Ogg et al.,
1999). Inducers of CYP3A4 activate the PXR to bind in a complex with
the retinoid X receptor to the ER6 DNA sequence (Blumberg et al., 1998;
Lehmann et al., 1998) and cells transiently transfected with PXR
expression vectors up-regulate ER6-reporter gene construct expression
in response to inducer treatment (Blumberg et al., 1998; Lehmann et
al., 1998). Data presented in this article indicate for the first time
that metyrapone is an inducer of CYP3A4 expression and an activator of
the human PXR [CYP3A5 was undetectable in preparation FT122, FT123,
and HTL98 (data not shown)]. Therefore, it is likely that metyrapone induced the CYP3A4 protein in preparations FT122 and HTL98, because it
has been shown that CYP3A7 protein, but not mRNA, is refractive to
induction by rifampicin in adult human hepatocyte culture (Gruet et
al., 1996)). Interestingly, CYP3A4 is not induced by either rifampicin
or metyrapone (implying a shared induction mechanism) in
preparation FT123 hepatocyte cultures (although CYP1A1 mRNA and CYP1A
protein are inducible in response to TCDD and omeprazole), and this
lack of induction may be associated with the low response in some
humans to CYP3A4 induction. Although relatively high concentrations of
metyrapone compared with rifampicin are required to induce CYP3A4 in
human hepatocytes, it should be noted that metyrapone may be
administered at high daily doses compared with other known CYP3A-inducing (PXR-activating) drugs (see Table
3). CYP3A4 is a major expressed CYP in
human gut and liver and is responsible for the metabolism of numerous
drugs as well as endogenous compounds such as steroids. The induction
of CYP3A4 by metyrapone could therefore result in a significant
alteration in the metabolism of any coadministered drugs or endogenous
steroids. The nature of any drug-steroid metabolism interaction is
likely to be complicated by a period of CYP inhibition, because
metyrapone is also an inhibitor of many CYP reactions.
|
This article indicates that metyrapone induces the expression of CYP3A4 likely through its activation of the human PXR in human hepatocytes. Although metyrapone induces the expression of rat liver CYP1A1 through a disruption in the homeostasis of an endogenous regulator, metyrapone does not induce a comparable level of induction of CYP1A1 in human liver. This species difference in the response of the CYP1A1 gene to induction by disruption in the homeostasis of an endogenous regulator may be specific to human liver and may be related to a relatively low responsiveness of this gene in the liver to induction by numerous inducers compared with rodents. The induction of CYP1A1 by metyrapone in human gut is likely to pose a greater problem to long-term treatment with metyrapone and is as yet unknown.
| |
Footnotes |
|---|
Received June 16, 1999; accepted September 23, 1999.
1 Present address: Department of Biochemistry and Molecular Biology, Royal Free Hospital School of Medicine, Rowland Hill St., London NW3 2PF, UK.
This work was supported in part by a short-term fellowship from the European Science Foundation (to J.L.H.).
Send reprint requests to: Dr. M. C. Wright, University Medicine, Level D, South Block (811), Southampton General Hospital, Tremona Road, Southampton SO16 6YD, UK. E-mail: mcw{at}soton.ac.uk
| |
Abbreviations |
|---|
Abbreviations used are:
CYP, cytochrome P-450;
AhR, aryl hydrocarbon receptor;
-NF, -naphthoflavone;
CAT, chloramphenicol acetyl transferase;
ER6, everted repeat;
Gra-PDH, glyceraldehyde phosphate dehydrogenase;
PXR, pregnane X
receptor;
TCDD, 2,3,7,8-tetrachlorodibenzo--dioxin;
XRE, xenobiotic
response element;
TBS-T, Tris-buffered saline containing 0.05% Tween
20;
DMEM, Dulbecco's modified Eagle's medium.
| |
References |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Nucleotide sequence and functional analysis.
J Biol Chem
265:
17221-17224.-hydroxylase by methopyrane (metopirone).
Endocrinology
73:
304-309.This article has been cited by other articles:
|
|
 |
|
  S. A. Kliewer, B. Goodwin, and T. M. Willson The Nuclear Pregnane X Receptor: A Key Regulator of Xenobiotic Metabolism Endocr. Rev., October 1, 2002; 23(5): 687 - 702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Luo, M. Cunningham, S. Kim, T. Burn, J. Lin, M. Sinz, G. Hamilton, C. Rizzo, S. Jolley, D. Gilbert, et al. CYP3A4 Induction by Drugs: Correlation between a Pregnane X Receptor Reporter Gene Assay and CYP3A4 Expression in Human Hepatocytes Drug Metab. Dispos., July 1, 2002; 30(7): 795 - 804. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. El-Sankary, G. G. Gibson, A. Ayrton, and N. Plant Use of a Reporter Gene Assay to Predict and Rank the Potency and Efficacy of CYP3A4 Inducers Drug Metab. Dispos., November 1, 2001; 29(11): 1499 - 1504. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
