![]() |
|
|
Vol. 28, Issue 7, 781-788, July 2000
Pharmagene plc, Orchard Road, Royston, Hertfordshire, United Kingdom
| |
Abstract |
|---|
|
|
|---|
Drug-induced changes in expression of cytochrome (CYP) P450 genes are a key cause of drug-drug interactions. Consequently, preclinical prediction of these changes by novel compounds is an integral component of drug development. To date, in vitro models of CYP induction have used mRNA measurement, immunodetection, and substrate metabolism as reporters. Here, we describe the application of quantitative real-time reverse transcriptase polymerase chain reaction to study CYP1A1 and CYP3A4 gene induction in 5-day-old cultures of human hepatocytes by known CYP inducers. After 5 days in culture, CYP1A1 expression was significantly elevated (5.1- to 26-fold; P < .01) in all four livers studied. In direct contrast, CYP3A4 mRNA levels consistently decreased during culture (80- to 300-fold; P < .001). In three independent experiments, a 48-h exposure to 3-methylcholanthrene, omeprazole, and lansoprazole significantly induced CYP1A1 expression in comparison to untreated cultures (P < .05). Rifampicin and solvent were without effect on CYP1A1 expression. Under identical experimental conditions, rifampicin and lansoprazole significantly elevated CYP3A4 mRNA expression (P < .05), whereas 3-methylcholanthrene, omeprazole, and dimethyl sulfoxide were without significant effect. These data demonstrate the applicability of quantitative reverse transcriptase polymerase chain reaction to the determination of gene dynamics in human hepatocytes. This offers a highly specific alternative to quantification of drug effects on CYP expression using immunodetection and substrate metabolism.
| |
Introduction |
|---|
|
|
|---|
Cytochrome P450s
(CYPs)1 comprise a
group of haem-containing proteins, some of which play a key role in the
metabolism, and hence the elimination, of a variety of chemically
diverse compounds, including pharmaceutical agents. The regulation of
gene expression is poorly understood for most CYPs, but it is well
documented that certain drugs can selectively modulate the expression
of a range of CYP genes (Denison and Whitlock, 1995
). When the result of drug administration is the induction of a CYP gene, differential or
alternative metabolism of other coadministered therapies may occur,
resulting in change of efficacy and possibly toxicity. Estimation of
CYP induction and prediction of drug-drug interactions is therefore an
important consideration for the development of novel therapeutic agents
(Park et al., 1996
). Predicting the ability of a drug to modulate CYP
expression at an early stage of its discovery and development should
reduce the risk of failure in the clinic and, more importantly, permit
the identification of alternative noninducing chemical structures.
Increasingly, preclinical evaluation of CYP induction is focused on
models using human tissue, most notably liver, because of documented
differences in the effects of CYP inducers between humans and other
species. To date, the most widely used model system has been cultured
human primary hepatocytes, because they contain a full complement of
CYPs, together with the appropriate receptors, drug response elements,
and transcriptional factors (Strom et al., 1996
). Cultures of human
hepatocytes have been shown to retain many aspects of liver function,
including CYP-mediated oxidation of drugs and CYP induction (for review
see Li et al., 1997a
).
Quantification of CYP induction has been achieved primarily by
measuring changes in the metabolism of CYP-selective substrates or by
direct quantification of CYP protein using specific antibodies and
Western blotting. More recently, direct study of CYP mRNA expression
has been used because up-regulation of CYP gene transcription and the
subsequent increase in protein levels are thought to be primarily
responsible for the enhanced metabolic function of CYPs after exposure
to inducers (Hankinson, 1995
; Honkakoski et al., 1998
; Lehmann et al.,
1998
). One possible exception is induction of CYP2E1 by ethanol and
isoniazid, which is thought to result either from protein stabilization
(Zand et al., 1993
) or increased protein translation (Park et al.,
1993
). Although some quantitative data have been reported, precise
quantification of mRNA expression by conventional methods such as
Northern blotting is unreliable, and use of reverse
transcriptase-polymerase chain reaction (RT-PCR) requires
elaborate methodology, which limits their use for routine prediction of
CYP induction.
The human CYP protein superfamily is encoded by at least 48 different genes. In addition, 14 human CYP pseudogenes, which do not encode functional protein, have been described. Thus, to obtain a comprehensive assessment of the ability of a drug to modulate CYP function through modulation of transcription requires a method that can dissect the effect of a drug on single CYP isoforms. Although it is possible to quantify single CYP proteins using selective antibodies, immunodetection of CYP proteins is plagued by uncertainty regarding antibody specificity because CYP families possess a high degree of protein sequence homology. Their use is, therefore, restricted to the few CYPs for which selective antibodies exist. The task is more difficult using metabolic substrates, given the polymorphic nature of certain CYPs in the human population (notably CYP2C9, CYP2C19, and CYP2D6), donor variability of CYP expression, and lack of absolute substrate specificity.
Here we describe the application of quantitative real-time reverse
transcriptase-polymerase chain reaction (QRT-PCR) to the measurement of drug induction of two CYP isoforms, CYP1A1 and CYP3A4,
in primary cultures of human hepatocytes. CYP1A1 was chosen for study
because of its well documented induction by aromatic hydrocarbons
(Hankinson, 1995
), and CYP3A4 because it is the most abundant form of
the hepatic CYPs (Shimada et al., 1994
), and is responsible for the
oxidative metabolism of two-thirds of pharmaceutical drugs tested
(Cholerton et al., 1992
). The activity of 3-methylcholanthrene (3-MC),
rifampicin, omeprazole, and lansoprazole was assessed because all are
known CYP inducers in vivo and in human primary hepatocytes (Li et al.,
1997a
).
| |
Materials and Methods |
|---|
|
|
|---|
Chemicals. Phenol red-free Williams' E medium, rat tail collagen, 3-MC, rifampicin, and lansoprazole were obtained from Sigma. Collagenase A was purchased from Boehringer. Omeprazole was extracted from Losec capsules using dimethyl sulfoxide (DMSO). Oligonucleotide primers and fluorogenic probes were purchased from PE Biosystems (Warrington, UK). TriZol and the remaining tissue culture materials were obtained from Life Technologies (Paisley, UK). All other reagents used in this study were of analytical grade and purchased from commercial sources.
Human Liver. The human livers used, together with donor-related information, are listed in Table 1. All livers were obtained through medically qualified intermediaries, with the full consent of the donor or the next-of-kin of the donor, together with the express approval of the local ethics committee and, where appropriate, the trust board of the hospital involved.
|
Isolation and Culture of Human Hepatocytes.
Samples of human liver were obtained from donors undergoing partial
hepatectomy. Immediately after resection, exposed vessels were
cannulated and the specimen was perfused with University of Wisconsin
solution. A catheter was introduced into the most prominent hepatic
blood vessel and secured with sutures. The remaining vessels on the cut
surface were ligated to improve perfusion of the tissue. The liver was
placed in University of Wisconsin solution and transported on ice to
our laboratory. Hepatocytes were isolated by collagenase digestion
essentially as described by Strom et al. (1982)
. Isolated hepatocytes
were resuspended in Williams' E medium supplemented with insulin (0.01 µg/ml) and hydrocortisone (0.005 µg/ml), and initial cell viability
was measured by Trypan blue dye exclusion. The hepatocyte preparations
used in this study had >86% initial cell viability (Table 1). The
cells were plated into collagen-coated 6-well plates (2 × 106 cells/well in 2 ml of medium) and cultured
for 3 days before induction experiments. Medium was changed daily.
Treatment of Cultures.
After 3 days of culture, human hepatocytes were treated with a number
of known CYP inducers for an additional 2 days. Effects of 3-MC were
studied at 1 µM, and rifampicin, omeprazole, and lansoprazole at 50 µM. All inducers were dissolved in DMSO, resulting in a final vehicle
concentration of 1% (v/v). Control (no vehicle) and DMSO-treated wells
were included in the experimental design to determine the effect of
DMSO on CYP mRNA expression. Separate control and DMSO wells were
required for each pair of drugs (Pair 1: 3-MC and rifampicin; Pair 2:
omeprazole and lansoprazole) due to the use of 6-well plates. Both
media and inducers were changed daily during treatment. After a 48-h
drug exposure, hepatocytes were treated with TriZol and extracts were
frozen at
80°C until use.
Extraction of Total RNA from Hepatocytes. Total RNA was extracted from hepatocytes using TriZol, a commercially available mixture of phenol and guanidine isothiocyanate, according to the protocol described by the manufacturer (Life Technologies). The concentration and purity of the RNA were determined by measurement of the optical densities at 260 and 280 nm. A ratio of >1.7 for A260/A280 was required for these studies. The RNA solutions were diluted to a working concentration of 1 µg/µl in nuclease-free water with the addition of RNase inhibitor (N808-0119; PE Biosystems).
Principles of TaqMan Technology.
A quantitative analysis of specific mRNA expression was performed by
QRT-PCR using the ABI Prism 7700 Sequence Detection System (PE
Biosystems). The system uses a fluorogenic probe to generate sequence-specific fluorescent signals during PCR. The probe is an
oligonucleotide with fluorescent reporter and quencher dyes attached,
designed from the mRNA sequence to hybridize to a region between the
forward and reverse PCR primers. While intact, the intensity of
reporter fluorescence is suppressed by the quencher. If the probe forms
part of a replication complex, the fluorescent reporter is cleaved from
the quencher by 5'
3' exonuclease activity inherent in
Taq polymerase.
|
Transcription Detection. Forward and reverse primers and the fluorogenic TaqMan probe were designed using Primer Express software (PE Biosystems) to amplify a 141 base pair fragment from the human CYP1A1 mRNA sequence (GenBank accession number AF040258).
Forward: 5' TGGTCTCCCTTCTCTACACTCTTGT 3' Reverse: 5' ATTTTCCCTATTACATTAAATCAATGGTTCT 3' Probe: 5' CAAGCATGCAAGTCAATGCAGGCT 3' A pair of primers and a TaqMan probe were also designed to amplify an 86 base pair fragment from the human CYP3A4 mRNA sequence (GenBank accession number D11131). Forward: 5' CTTCATCCAATGGACTGCATAAAT 3' Reverse: 5' TCCCAAGTATAACACTCTACACAGACAA 3' Probe: 5' CCGGGGATTCTGTACATGCATTG 3' In addition, a pair of primers and a TaqMan probe were designed to amplify a 78 base pair portion of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript that spans an exon/exon boundary. GAPDH is a ubiquitously expressed "housekeeping" gene, and was used to provide an internal marker of mRNA integrity within the experiment. Forward: 5' GAAGGTGAAGGTCGGAGTCAAC 3' Reverse: 5' CAGAGTTAAAAGCAGCCCTGGT 3' Probe: 5' TTTGGTCCGTATTGGGCGCCT 3' The CYP probes were labeled with the fluor 6-carboxyfluorescein, the GAPDH probe with the fluor JOE. Both fluors were quenched with carboxytetramethyl rhodamine. Total RNA samples were treated with RNase-free DNase I (amplification grade; Life Technologies) according to the manufacturers' instructions. For each RNA sample, 100 ng was then used as template for first strand cDNA synthesis. The RNA in a volume of 4 µl and in the presence of reverse primers for CYP1A1, CYP3A4, and GAPDH, 1 × PCR buffer II (PE Biosystems), and 5 mM MgCl2 was heated to 72°C for 5 min and cooled slowly to 55°C. After addition of all other reagents, the 6-µl reaction was incubated at 37°C for 30 min followed by an enzyme inactivation step of 90°C for 5 min. The final reaction conditions for reverse transcription were as follows: 1 × PCR buffer II; 5 mM MgCl2; 1 mM dATP, dGTP, and dCTP; 2 mM dTTP; 12.5 U MuLV reverse transcriptase (Life Technologies). The resulting cDNA was subjected to PCR amplification in the ABI 7700 Sequence Detection System to identify either CYP1A1 or CYP3A4 PCR product in conjunction with GAPDH transcripts in a single reaction. Final reaction conditions were 4% glycerol; 0.66 × TaqMan buffer A (PE Biosystems); 6 mM MgCl2; 358 µM dATP, dUTP, dGTP, and dCTP; 2.5 U AmpliTaq Gold; and 0.16 U of AmpErase UNG (uracil N-glycosylase). An initial enzyme activation step of 94°C for 12 min was followed by 45 PCR cycles each of 95°C for 15 s, 60°C for 30 s.Transcription Quantification. Standard curves have been generated for >100 different targets using 3, 6, 15, 30, and 60 ng of sheared genomic DNA, equivalent to 1,000, 2,000, 5,000, 10,000, and 20,000 copies of the human male genome, respectively. Reactions were carried out in duplicate under identical conditions to those described above. The criteria for successful primer/probe design are extremely rigorous, and it has been our experience that the efficiency of amplification with sets that conform is very high. Primer/probe sets were designed according to the parameters incorporated in the Primer Express software (PE Biosystems). The primer/probe sets were homology-searched to ensure that they were specific for the target mRNA transcript using an NCBI BLAST search. We have determined the frequency distribution of the data points from a large number of standard curves generated with different primer/probe sets and have found that they are very tightly grouped. Therefore, we have used these data to generate a global standard curve that is used to quantify all target mRNA copy numbers (Fig. 1). The relationship between log Cn and Ct is linear. Using interpolation, the Ct at which the accumulated fluorescent signal exceeded a predetermined threshold level above background was compared with the global standard curve to generate a starting copy number for the CYP1A1 and CYP3A4 transcripts.
Statistical Analysis. The effects of test compounds on CYP1A1 and CYP3A4 mRNA expression were determined in hepatocytes from three different donors. Each determination was performed in triplicate, and data are presented as means ± S.E. The effect of culture on CYP expression was analyzed using a two-tailed paired Student's t test. Statistical significance between control and treated hepatocytes was calculated by one-way ANOVA and post hoc Dunnett's test, using DMSO as the reference treatment group. Primary statistical calculations were performed on Ct and not Cn values because the latter varies asymmetrically with respect to PCR cycle number.
| |
Results |
|---|
|
|
|---|
Quantification of CYP1A1 and CYP3A4 mRNA. Sufficient total RNA was obtained from 4 million human hepatocytes for parallel quantification of CYP1A1 and CYP3A4 mRNA. Both CYP1A1 and CYP3A4 genes were abundantly expressed, readily permitting quantification using real-time RT- PCR (Fig. 2). The maximum fluorescent signal obtained with the CYP1A1 TaqMan probe was approximately 10, whereas that for CYP3A4 was lower, at about 8. The difference is most probably due to differential 6-carboxyfluorescein labeling of the probes, because studies using genomic DNA indicate that they amplify with similar efficiencies. When interpreting amplification plots, it is important to realize that samples expressing higher levels of message achieve threshold fluorescence at low cycle numbers (i.e., low Ct values), whereas low expression is associated with high Ct values. The highest Ct obtained with any sample in this study was 26, much lower than the number of cycles followed in the experiment (45), clearly demonstrating that the sensitivity of the technology is adequate for reliable quantification of CYP mRNA expression. In addition, positive GAPDH amplification was measured for all samples (data not shown), confirming the integrity of RNA used in the assays.
|
Effect of Culture on CYP mRNA Expression. CYP1A1 and CYP3A4 mRNA expression was quantified both immediately after hepatocyte isolation and after 5 days in medium to determine the effect of culture. Immediately post-isolation, the lowest expression of CYP1A1 was detected in donor 1 (6940 copies/100 ng of total RNA), whereas donor 4 expressed 9-fold higher levels (60,600 copies/100 ng of total RNA). After 5 days of culture, CYP1A1 expression increased by between 5.1- and 26-fold in the cells from the four livers studied; this increase was statistically significant (P < .01; Fig. 3A). In direct contrast, culture of hepatocytes was associated with a highly significant reduction of CYP3A4 expression (P < .001; Fig. 3B), corresponding to a decrease to about 1% of initial levels. In freshly isolated hepatocytes, expression of CYP3A4 mRNA was approximately two orders of magnitude higher than CYP1A1.
|
Effect of Inducers on CYP mRNA Expression. The levels of gene expression for CYP1A1 and CYP3A4 were studied in 5-day-old cultures of human hepatocytes after a 48-h exposure to known CYP inducers. Data for CYP expression in three different preparations of hepatocytes are shown in Figs. 4 and 5. None of the treatments produced any visible toxic effect (i.e., cell death, loss of adhesion) on hepatocytes at the study concentrations, as assessed microscopically.
|
|
| |
Discussion |
|---|
|
|
|---|
Enhancement and inhibition of CYP function in humans are common
causes of the failure of new drugs in clinical studies. To reduce the
incidence of such effects, suitable robust and predictive preclinical
tests must be applied. The direct inhibitory effect of a drug on CYP
function can be assessed in numerous experimental models, most commonly
through the study of substrate metabolism in human liver microsomes, or
by cloned or purified enzymes (Crespi et al., 1997
; Crespi, 1999
).
Demonstration of drug-induced changes of CYP activity, however,
requires use of intact human hepatocytes, so that the experimental
system contains the full complement of required transduction components.
There have been substantial advances in human hepatocyte isolation and
culture methods after early reports by Strom et al. (1982)
. The
scarcity of high-quality human liver samples has demanded increasingly
sensitive detection protocols that use smaller numbers of cells to
maximize the information that can be retrieved from each hepatocyte
preparation (Donato et al., 1995
; Silva et al., 1998
). However, the
commonly applied detection methods of Western blotting or substrate
metabolism lack sensitivity and sufficient selectivity to provide a
comprehensive induction profile for all members of the CYP family of
enzymes. Because increased transcription of CYP genes is thought to
underpin most CYP induction, many researchers have attempted to
quantify specific mRNA levels using RT-PCR (Gonzalez, 1988
). Detection
of CYP mRNA has been used to demonstrate induction of CYP3A4 (Sumida et
al., 1999
) and CYP7A1 (Andreou and Prokipcak, 1998
) in HepG2 cells. In
addition, mRNA levels for CYP1A1 (Greuet et al., 1997
; Shih et al.,
1999
), CYP1A2 (Donato et al., 1998
; Shih et al., 1999
), and CYP3A4
(Greuet et al., 1997
; Donato et al., 1998
) have been shown to be
inducible in human primary hepatocytes. The methods of mRNA
quantification used by these groups were relatively elaborate to
overcome intrinsic features of RT-PCR that lead to semiquantitative
data. The main problem is the inherent saturation that occurs in the
PCR amplification process, which can complicate "endpoint" assays,
and lead to incorrect interpretation of starting mRNA abundance (Murphy
et al., 1990
; Wiesner et al., 1992
). This is exemplified in Fig. 2B,
where the amount of fluorescence after 45 cycles of PCR demonstrates
that CYP3A4 mRNA was present in all three samples, but the magnitude of
the signal is similar in all cases, and does not reflect the marked
rifampicin-induced CYP3A4 gene expression. Numerous
methods have been developed to achieve quantification using RT-PCR; for
example, use of competitive DNA fragments (Siebert and Larrick,
1993
) or termination assays in which the PCR process is stopped after a
predetermined number of cycles (Mattes and Li, 1997
). None, however,
offers the reliability or simple detection of PCR product in real time
associated with QRT-PCR used in this study.
In this study, we applied QRT-PCR to the analysis of CYP1A1
and CYP3A4 gene induction in primary hepatocytes in a
process that allows the parallel assessment of multiple gene targets in single extracts of hepatocyte RNA. Real-time measurement of the amount
of PCR product at each cycle of PCR is achieved by measuring cleavage
of a fluorescent TaqMan probe using the ABI Prism 7700 Sequence
Detection System (PE Biosystems). PCR amplification is performed in
96-well plates, and accumulation of PCR product is quantified in
real-time by fluorometric detection. This permits the parallel
assessment of mRNA expression of all the major CYP isoforms, together
with other phase I enzymes, such as alcohol dehydrogenase, monoamine
oxidase, and aromatases, and phase II enzymes, such as
glucuronyltransferase, sulfotransferase, glutathione transferase, and
N-acetyl transferase. The importance of phase II induction
is currently being reappraised in the light of reports of
UDP-glucuronyltransferase inducibility (Abid et al., 1997
; Masubuchi et
al., 1997
). Rifampicin and ganciclovir have also been reported to
increase zidovudine metabolism, possibly via induction of zidovudine
glucuronidation (Burger et al., 1994
).
CYP1A1 and CYP3A4 mRNA levels in freshly isolated human hepatocytes
were about 10,000 and 1,000,000 copies per 100 ng of total RNA,
respectively, suggesting that functionally, CYP3A4 may be the more
abundant isoform (Fig. 2). However, because determinations of CYP mRNA
expression made in this study were not directly compared with either
protein abundance or functional activity, a direct correlation cannot
be made. We have also found no literature data with which to compare
our determination of basal CYP1A1 and CYP3A4 mRNA expression. Mattes
and Li (1997)
estimated CYP3A (primers recognized CYP3A3 and CYP3A4
cDNA transcripts) expression at 73,000 copies per 100 ng of total RNA
in a single preparation of human hepatocytes, after 7 days of culture,
somewhat lower than that obtained by QRT-PCR in this study. There are
many differences between the two studies, most notably different
culture times, quantification method, and RNA extraction methodology,
making any quantitative comparison unreliable. In addition, Mattes and Li did not prevent or correct for possible contribution of genomic DNA
contamination in their assay, so that their measurements using RT-PCR
amplification may be an overestimate of CYP3A mRNA. All samples in this
study were treated with DNase to remove any contaminating DNA before
reverse transcription of mRNA to cDNA.
In models of hepatic CYP induction, primary hepatocytes are routinely
cultured for 2 to 3 days before the start of treatment with inducer (Li
et al., 1997a
). One of the reasons for culture before exposure to
inducer is the rapid decline in metabolic activity that is observed
during the first few days post-isolation, enabling drug-induced changes
in CYP activity to be measured against a lower baseline, using
immunoblotting and substrate metabolism (Grant et al., 1987
; Li et al.,
1995
). In our experiments, CYP3A4 mRNA expression declined considerably
during culture (to about 1% of initial levels), which correlates well
with previous studies using immunoblotting (Silva et al., 1998
) and
substrate metabolism (Li et al., 1995
). In direct contrast, CYP1A1 mRNA
levels increased significantly in all donors (5- to 26-fold increase).
There is little literature evidence with which to compare this finding. Interestingly, CYP1A activity as measured by O-dealkylation
of ethoxyresorufin has been shown to decline in a similar manner to
CYP3A4 in human hepatocytes (Grant et al., 1987
). It is, however, difficult to differentiate the metabolic effects of CYP1A1 from its
isoform CYP1A2, with which it shares a similar substrate profile. This
reduction in ethoxyresorufin metabolism may therefore be attributable
to loss of CYP1A2 activity, masking an up-regulation of CYP1A1.
To investigate the applicability of QRT-PCR to measurement of CYP
induction, the effects of four known inducers on CYP1A1 and CYP3A4
expression were measured. 3-MC, omeprazole, and lansoprazole all
significantly increased CYP1A1 expression after a 48-h exposure in
three donors. These data are consistent with the known action of 3-MC
(Morel et al., 1990
; Donato et al., 1995
; Masubuchi et al., 1998
),
omeprazole (Diaz et al., 1990
; Curi-Pedrosa et al., 1994
; Masubuchi et
al., 1998
), and lansoprazole (Curi-Pedrosa et al., 1994
; Masubuchi et
al., 1998
) in human hepatocytes. The inactivity of rifampicin on CYP1A1
expression also correlates with literature findings (Curi-Pedrosa et
al., 1994
; Silva et al., 1998
). Likewise, up-regulation of CYP3A4
expression by rifampicin (Morel et al., 1990
; Gillum et al., 1993
;
Kocarek et al., 1995
; Greuet et al., 1997
; Li et al., 1997b
) and
lansoprazole (Curi-Pedrosa et al., 1994
; Masubuchi et al., 1998
) and
the trend toward induction by omeprazole (Curi-Pedrosa et al., 1994
)
are consistent with previously published information. Furthermore, the
inability of 3-MC to affect mRNA levels for CYP3A4 supports the use of
this approach to define the profile of CYP induction activity for test compounds.
In conclusion, we have described the application of QRT-PCR to the investigation of CYP induction in cultures of human hepatocytes. The technology is able to quantify CYP mRNA with ample sensitivity, permitting the determination of changes in mRNA expression caused by treatment with known inducers of CYP1A1 and CYP3A4 enzymes. Being 96-well-based, several hundred QRT-PCR reactions can be performed daily, allowing screening of chemical series and not just selected lead molecules. In addition, parallel analysis of multiple mRNA species in the same hepatocyte total RNA extracts reduces intersample variation, lowers hepatocyte usage, and permits the profiling of families of genes. QRT-PCR therefore permits a comprehensive assessment of the ability of a drug to modulate hepatic gene expression, including those encoding CYP enzymes, thus offering a sensitive, specific, and rapid alternative to quantification of gene induction by immunodetection or substrate metabolism.
| |
Footnotes |
|---|
Received December 7, 1999; accepted April 3, 2000.
Send reprint requests to: Wayne P Bowen, Ph.D., Pharmagene plc, Orchard Road, Royston, Hertfordshire, SG8 5HD, UK. E-mail: wayne.bowen{at}pharmagene.com
| |
Abbreviations |
|---|
Abbreviations used are: CYP, cytochrome P450; QRT-PCR, quantitative real-time reverse transcriptase-polymerase chain reaction; RT-PCR, reverse transcriptase-polymerase chain reaction; Ct, threshold cycle; Cn, starting mRNA copy number; 3-MC, 3-methylcholanthrene; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DMSO, dimethyl sulfoxide.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Johansson, U. Jurva, G. Gronberg, L. Weidolf, and C. Masimirembwa Novel Metabolites of Amodiaquine Formed by CYP1A1 and CYP1B1: Structure Elucidation Using Electrochemistry, Mass Spectrometry, and NMR Drug Metab. Dispos., March 1, 2009; 37(3): 571 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Sane, D. J. Buckley, A. R. Buckley, S. C. Nallani, and P. B. Desai Role of Human Pregnane X Receptor in Tamoxifen- and 4-Hydroxytamoxifen-Mediated CYP3A4 Induction in Primary Human Hepatocytes and LS174T Cells Drug Metab. Dispos., May 1, 2008; 36(5): 946 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. I. Somers, N. Lindsay, B. M. Lowdon, A. E. Jones, C. Freathy, S. Ho, A. J. M. Woodrooffe, M. K. Bayliss, and G. R. Manchee A Comparison of the Expression and Metabolizing Activities of Phase I and II Enzymes in Freshly Isolated Human Lung Parenchymal Cells and Cryopreserved Human Hepatocytes Drug Metab. Dispos., October 1, 2007; 35(10): 1797 - 1805. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, M. Zhao, P. He, M. Hidalgo, and S. D. Baker Differential Metabolism of Gefitinib and Erlotinib by Human Cytochrome P450 Enzymes Clin. Cancer Res., June 15, 2007; 13(12): 3731 - 3737. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lindeberg, K. Carlstrom, O. Ritvos, and O. Hovatta Gonadotrophin stimulation of non-luteinized granulosa cells increases steroid production and the expression of enzymes involved in estrogen and progesterone synthesis Hum. Reprod., February 1, 2007; 22(2): 401 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Baldwin, J. L. Bramhall, C. A. Ashby, L. Yue, P. R. Murdock, S. R. Hood, A. D. Ayrton, and S. E. Clarke CYTOCHROME P450 GENE INDUCTION IN RATS EX VIVO ASSESSED BY QUANTITATIVE REAL-TIME REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (TAQMAN) Drug Metab. Dispos., June 1, 2006; 34(6): 1063 - 1069. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhuo, N. Zheng, C. A. Felix, and I. A. Blair KINETICS AND REGULATION OF CYTOCHROME P450-MEDIATED ETOPOSIDE METABOLISM Drug Metab. Dispos., September 1, 2004; 32(9): 993 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Davis, K. J. Page, G. J. Dos Santos Cruz, D. W. Harmer, P. W. Munday, S. J. Williams, J. Picot, T. J. Evans, R. L. Sheldrick, R. A. Coleman, et al. Expression and Functions of the Duodenal Peptide Secretin and its Receptor in Human Lung Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 302 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tateno, Y. Yoshizane, N. Saito, M. Kataoka, R. Utoh, C. Yamasaki, A. Tachibana, Y. Soeno, K. Asahina, H. Hino, et al. Near Completely Humanized Liver in Mice Shows Human-Type Metabolic Responses to Drugs Am. J. Pathol., September 1, 2004; 165(3): 901 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Komoroski, S. Zhang, H. Cai, J. M. Hutzler, R. Frye, T. S. Tracy, S. C. Strom, T. Lehmann, C. Y. W. Ang, Y. Y. Cui, et al. INDUCTION AND INHIBITION OF CYTOCHROMES P450 BY THE ST. JOHN'S WORT CONSTITUENT HYPERFORIN IN HUMAN HEPATOCYTE CULTURES Drug Metab. Dispos., May 1, 2004; 32(5): 512 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Anakk, C. Y. Ku, M. Vore, and H. W. Strobel Insights into Gender Bias: Rat Cytochrome P450 3A9 J. Pharmacol. Exp. Ther., May 1, 2003; 305(2): 703 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Basten, Y. Bao, and G. Williamson Sulforaphane and its glutathione conjugate but not sulforaphane nitrile induce UDP-glucuronosyl transferase (UGT1A1) and glutathione transferase (GSTA1) in cultured cells Carcinogenesis, August 1, 2002; 23(8): 1399 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Rae, M. D. Johnson, M. E. Lippman, and D. A. Flockhart Rifampin Is a Selective, Pleiotropic Inducer of Drug Metabolism Genes in Human Hepatocytes: Studies with cDNA and Oligonucleotide Expression Arrays J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 849 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Burczynski, M. McMillian, J. B. Parker, S. Bryant, A. Leone, E. R. Grant, J. M. Thorne, Z. Zhong, R. A. Zivin, and M. D. Johnson Cytochrome P450 Induction in Rat Hepatocytes Assessed by Quantitative Real-Time Reverse-Transcription Polymerase Chain Reaction and the RNA Invasive Cleavage Assay Drug Metab. Dispos., September 1, 2001; 29(9): 1243 - 1250. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||