![]() |
|
|
Vol. 29, Issue 3, 274-281, March 2001
Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Aramaki-Aoba, Aoba-ku, Sendai, Japan (W.H., Y.K., K.Y., M.S., K.N., Y.Y.); and Department of Anatomic Pathology, School of Medicine, Tohoku University, Aoba-ku, Sendai, Japan (H.S.)
| |
Abstract |
|---|
|
|
|---|
Cytosolic sulfotransferases, which mediate activation and detoxification of both endogenous and exogenous compounds, consist of at least five different gene families (ST1 to ST5) in mammals. Several cDNAs corresponding to ST1A forms have been reported, but their functional properties are not well characterized. In addition, only a single form of ST1A sulfotransferase has been reported in each experimental animal species despite the expressions of plural forms in humans. Therefore, enzymatic properties of human ST1A3, ST1A5, rat ST1A1, mouse St1a4, and newly isolated rabbit ST1A8 have been characterized and compared by use of their recombinant proteins to clarify the functional difference between human and experimental animal ST1A forms. From the results using more than 25 phenolic chemicals, all the experimental animal ST1A forms showed substrate specificities similar to human ST1A3 rather than ST1A5. They showed high affinities toward p-nitrophenol and 6-hydroxymelatonin as found in human ST1A3. These forms also showed high activities toward umbelliferone and naringenin, but very low activities toward catecholamines, representative substrates of human ST1A5. Hepatic contents of experimental animal ST1A forms varied (66-250 pmol/mg of cytosolic protein) but showed the same order as observed with human ST1A3 (120 pmol/mg). Hepatic content of human ST1A5 was about 19-fold less than that of ST1A3. Therefore, ST1A forms identified in experimental animal species correspond to human ST1A3 functionally. For chemicals such as troglitazone and 2-amino-4'-hydroxy-1-methyl-6-phenylimidazo[4,5-b]pyridine, clear species differences were detected among the ST1A forms examined.
| |
Introduction |
|---|
|
|
|---|
Sulfation
plays key roles in detoxification and activation of various endogenous
and exogenous compounds such as hormones, neurotransmitters, drugs, and
carcinogens (De Meio, 1975
; Jakoby et al., 1980
; Yamazoe and Kato,
1995
). These reactions are catalyzed by cytosolic sulfotransferases
(STs1) in mammals, which transfer
SO3
(sulfate moiety) from
3'-phosphoadenosine-5'-phosphosulfate (PAPS) to substrates.
Species differences are often observed on sulfations of chemicals among
human and experimental animal species. For example, a model substrate,
7-hydroxycoumarin (umbelliferone), was preferentially conjugated with
sulfate in precision-cut liver slices from rats and mice. The rates of
glucuronidation and sulfation were, however, similar in guinea pig,
monkey, and human (Steensma et al., 1994
). Mechanisms yielding species
differences remained unclear and thus hamper the prediction of the
metabolic property of chemicals in humans from experimental animal data.
STs are known to constitute a gene superfamily. This superfamily
contains at least five different classes, ST1, ST2, ST3, ST4, and ST5
families in mammals, which are based on their similarities of deduced
amino acid sequences (Yamazoe et al., 1994
; Weinshilboum et al., 1997
;
Nagata and Yamazoe, 2000
). ST1 family is further subdivided into five
subfamilies: ST1A, ST1B, ST1C, ST1D, and ST1E.
ST1A forms mainly mediate sulfations of phenols. From human-derived
cDNA libraries, three distinct cDNAs of ST1A forms, ST1A2 (also called
STP2 or SULT1A2), ST1A3 (STP1, TS-PST, or SULT1A1), and ST1A5 (STM,
TL-PST, or SULT1A3), have been isolated and characterized (Zhu et al.,
1993
; Ozawa et al., 1994
; Dooley and Huang, 1996
). ST1A2 and ST1A3
catalyze the sulfations of simple phenolic chemicals such as
p-nitrophenol (p-NP). ST1A3 shows higher
catalytic activity and affinity for p-NP than does ST1A2. In
contrast, ST1A5 shows a trivial activity for p-NP, but has
high affinity for dopamine (Veronese et al., 1994
; Lewis et al., 1996
;
Fujita et al., 1999b
). These data indicate the distinct substrate
specificities of ST1A form in spite of their high extents of sequence similarity.
Several cDNAs corresponding to ST1A forms have been isolated from
experimental animal species (Fig. 1).
Enzymatic properties of these forms have not been characterized except
rat ST1A1 (Ozawa et al., 1993
), bovine ST1A6 (Henry et al., 1996
), and
dog ST1A7 (Oddy et al., 1997
). Rat ST1A1 was isolated and characterized as the first ST1A form by our laboratory (Ozawa et al., 1990
). Mouse
St1a4 cDNA was also isolated (Kong et al., 1993
), but the enzymatic
property remains yet to be characterized. We have recently isolated a
new ST1A cDNA from a male rabbit liver library and termed it ST1A8.
|
Enzymatic properties of human and experimental animal ST1A forms have been characterized using model substrates such as p-NP and dopamine, but not simultaneously compared using recombinant ST1A forms. Different from human forms, only a single form of ST1A has been reported so far from each experimental animal species. These phenomena may imply the functional difference of ST1A forms among experimental animal species and humans. In addition, absolute tissue contents of each ST1A form have not been determined. Therefore, to address the underlying mechanism of apparent species difference in sulfations of chemicals, the present study has been done using the recombinant enzymes.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Restriction endonucleases, DNA modifying enzymes, and TaKaRa EX
Taq were purchased from Takara Shuzo (Kyoto, Japan). A
gt11 cDNA library of a male rabbit liver was obtained from CLONTECH (Palo Alto, CA). Enterokinase was obtained from Biozyme Laboratories, Ltd. (Gwent, UK).
2-Amino-4'-hydroxy-1-methyl-6-phenylimidazo[4,5-b]pyridine (4'-OH-PhIP) was kindly donated by Dr. K. Wakabayashi (National Cancer
Center Research Institute, Tokyo, Japan) and
3-hydroxybenzo[a]pyrene (3-OH-B[a]P) was a
generous gift from Dr. H. V. Gelboin (National Cancer Institute,
Bethesda, MD). Sakuranetin and 5,7-dihydroxyflavanone were kindly
donated from Prof. T. Kurokawa (School of Medicine, Tohoku University,
Sendai, Japan). Isopropyl
-D-thiogalactopyranoside, dithiothreitol,
alkalinephosphatase-conjugated goat anti-rabbit IgG,
5-bromo-4-chloro-3-indolylphosphate, nitro blue tetrazonium, mefenamic
acid, and phenolic chemicals used as substrates were purchased from
Sigma Chemical Co. (St. Louis, MO). [35S]PAPS
(2000 mCi/mmol) was from New England Nuclear (Boston, MA). QIAexpress
and Ni-nitrilotriacetic acid agarose were the product of Qiagen
(Chatsworth, CA). Bio-Rad protein assay kit and SDS-polyacrylamide gel
electrophoresis (PAGE) molecular weight standards (low range) were from
Bio-Rad (Richmond, CA). All other chemicals used were of the highest
grade available.
Methods.
Isolation of rabbit ST1A form (ST1A8) cDNA
A
gt11 cDNA library of a male rabbit liver was immunoscreened with
anti-
His-rat ST1A1 polyclonal antibody by the modified method as
reported previously (Yoshinari et al., 1998
). After the third
screening, positive clones were isolated and purified. Then, DNA
sequences of each clone were determined separately using dye primers
and Thermo Sequenase with ABI373A DNA sequencer (Perkin Elmer Japan,
Tokyo, Japan) according to the dideoxy method in conjugation
with M13 phage cloning as described (Sambrook et al., 1989
). The DNA
sequences of the positive clones coincided with each other. Two
oligonucleotides (rab.ST1A-5':
GCGGATCCGATGACGATGACAAAATGGAGCTCATCCAGGACACGTCCCGC, and
rab.ST1A-3': GCGCATGCCCCCTCACAGCTCTGAACGGAAGG) were designated to
construct the expression vector. Oligonucleotides have BamHI and SphI restriction sites, respectively. The designated
(rabbit ST1A82)
cDNA fragment was obtained by PCR. The PCR reaction mixture (50 µl)
contained 5 ng of the template cDNA; 10 pmol of each 5' and 3' primers;
0.2 mM each of dATP, dCTP, dTTP, and dGTP; 0.5 units of TAKARA Ex
Taq; and the Ex Taq buffer. After an initial denaturation at 94°C for 3 min, the amplification was performed for
25 cycles, with 1 min at 94°C for denaturation, 30 s at 55°C for annealing, 1 min at 72°C for extension, and a final extension period of 2 min at 72°C.
Construction of expression vectors, expression and purification
of recombinant ST1A proteins.
Designated ST1A cDNA fragments contained nucleotides encoding seven
additional amino acid residues (GlySerAspAspAspAspLys), in which was
included a sequence of recognition sites of enterokinase next to the
N-terminal methionine of the native form. Designated human ST1A3,
ST1A5, and rat ST1A1 cDNA fragments were obtained by PCR as described
(Fujita et al., 1999a
,b
). The mouse St1a4 fragment was also obtained by
PCR from a male mouse liver cDNA library using oligonucleotides as the
primers (mST1A-5': GCGGATCCGATGACAAAATGGCTCAGAACCCCAGC, and
mST1A-3': GCGTCGACCAGTGTTAGGACTGATGGC). They have BamHI and SalI restriction sites, respectively.
His-ST1A proteins for
standards of immunoblot analyses by use of enterokinase as described
(Fujita et al., 1997Antibody preparation and immunoblot analysis.
Japanese White rabbits (2.5 kg, female) were immunized intradermally
with 20 to 50 µg of each purified
His-ST1A protein in complete
Freund's adjuvant, and immunity was boosted intravenously with 20 to
50 µg of the protein 3 weeks later. One week after the boost,
antisera were obtained and kept at
80°C until use.
His-ST1A
protein, alkalinephosphatase-conjugated goat anti-rabbit IgG,
5-bromo-4-chloro-3-indolylphosphate, and nitro blue tetrazonium as
described (Blake et al., 1984
His-ST1A5 protein were used. The stained sheets were
scanned with Nikon AX-1200 and their intensities were measured by use
of the NIH image (version 1.59) software (Bethesda, MD). The
contents of each ST1A form in liver cytosols were determined using
corresponding
His-ST1A proteins as the standards. The antibodies did
not cross-react with other subfamilies of ST1 forms (ST1B, ST1C, ST1D,
and ST1E) and ST2A forms. Molecular weights of 34,157 for
His-ST1A5;
34,171 for
His-ST1A3; 33,867 for
His-ST1A1; 34,677 for
His-St1a4; and 33,802 for
His-ST1A8, which were derived from
their deduced amino acid sequences, were used for the determination of
contents of each ST1A form.
Assay of sulfation.
Sulfating activities were determined by the radioactivities of the
metabolites obtained with [35S]PAPS as a
sulfate donor after thin layer chromatography (Yoshinari et al., 1998
).
A typical incubation mixture consisted of 50 mM Tris-HCl buffer (pH
7.4), 1 mM dithiothreitol, 20 mM MgCl2, 10 µM substrate, 125 µM [35S]PAPS (0.1-0.2
Ci/mmol), and 50 ng of His-ST1A protein in a final volume of 10 µl.
The reaction was initiated by addition of
[35S]PAPS and terminated by addition of 5 µl
of chilled acetonitrile after incubation at 37°C for 20 min. A
portion (10 µl) of the reaction mixtures was applied to a thin layer
plate (chromatogram sheet 13255; Kodak, Rochester, NY; or thin layer
chromatography aluminum plate silica gel 60; Merck, Darmstadt,
Germany). Metabolites on the chromatogram were developed with a
solvent system of n-propanol/ammonia/water (6:3:1). The
radioactive spots were analyzed by a BAS1000 image analyzer (FujiFilm,
Tokyo, Japan). All the substrates dissolved in dimethyl sulfoxide
(DMSO) were added to make the final DMSO concentration 0.01 to 0.04%.
In the case of inhibitory assays, the final 0.08% DMSO concentration
was used. Sulfating activities showed less than 3% difference between
experiments with 0.04 and 0.08% DMSO toward salicylic acid,
6-hydroxymelatonin, harmol, naringenin, and dopamine. Molecular weights
of 36,160 for His-ST1A5; 36,174 for His-ST1A3; 35,870 for His-ST1A1;
36,680 for His-St1a4; and 35,805 for His-ST1A8, which were derived from
their deduced amino acid sequences, were used for the determination of
each sulfating activity. ST1 families' Km
values for PAPS are about 0.5 to 1.0 µM (Fujita et al., 1999b
), and
there are species differences in PAPS tissue concentrations (Klaassen
and Boles, 1997
). In the present study, we used a high PAPS
concentration (125 µM) and relatively short-periods of incubation to
minimize the deviation of the reaction. Deviations start to occur over
20 µM p-NP and troglitazone under our assay conditions.
| |
Results |
|---|
|
|
|---|
Comparison of Deduced Amino Acid Sequences.
The deduced amino acid sequences of ST1A forms examined in the present
study (human ST1A3, ST1A5, rat ST1A1,
mouse St1a4, and rabbit ST1A8) and the percentage of identities are
shown in Fig. 2 and Table 1,
respectively. These ST1A forms share more than 69% identity with each
other. The highest homology is observed between ST1A3 and ST1A5 (93%).
All the experimental animal ST1A forms show slightly higher identities
with human ST1A3 than ST1A5. Especially rabbit ST1A8, newly isolated
from a male rabbit liver, is more closely related (more than 81%
identities) to the human ST1A forms than equivalents in rat and mouse
(Table 1). As shown in Fig. 2, arrows indicating 121Gln, 185Thr, and
267Thr of ST1A3 and corresponding positions of other ST1A forms are
selective residues to ST1A forms. Site A
(LA/SLLPQ/ET/SLLDQKVV/IKVV/IY),
site B
(LS/RR/HTHPV),
and site C (SLPEET) are highly conserved within ST1A forms, but differ
from all the other families or subfamilies of cytosolic
sulfotransferases reported (ST1 to ST5 families). The newly isolated
ST1A8 also conserves the corresponding positions and regions. Among
these sites, site A has been recognized as a variable region among
cytosolic sulfotransferases (Yamazoe et al., 1994
; Varin et al., 1995
;
Weinshilboum et al., 1997
).
|
|
Contents of ST1A Proteins in Liver Cytosols.
To clarify the enzymatic properties of ST1A forms, recombinant ST1A
proteins, termed His-ST1As, were expressed in E. coli and
purified by nickel-affinity chromatography. Contents of ST1A forms in
liver cytosols were determined by immunoblot analyses using each
anti-
His-ST1A antibody and corresponding
His-ST1A protein as the
standard (Table 2). The antibodies did
not cross-react with other ST1 subfamilies (ST1B, ST1C, ST1D, and ST1E
forms) and ST2A forms. ST1A3 and ST1A5 are immunostained with
anti-
His-ST1A5 antibodies, but distinguished by their different
mobilities on SDS-PAGE.
|
Sulfating Activities (Comparison of Substrate Specificities).
The His-ST1A proteins have 17 additional amino acid residues
(MetArgGlySerHisHisHisHisHisHisGlySerAspAspAspAspLys), including a
histidine tag and a sequence for the recognition site of enterokinase next to the N-terminal methionine of the native form. The additional peptide fused to the N terminus of STs has been shown to have minimal
influence on kinetic parameters (Marsolais and Varin et al., 1995
;
Fujita et al., 1999a
), although a slight difference was observed on
isoproterenol sulfation (Lewis et al., 1996
). In our experiments using
His-ST1A3 and
His-ST1A3, both proteins showed consistent results on
p-NP sulfation (Km = 3.00 and
2.62 µM, Vmax = 3.98 and 3.47 nmol/nmol/min,
Vmax/Km = 1.32 and 1.33, respectively). Thus, His-ST1A was used for our present
experiments as shown below.
|
|
|
|
|
Influence of Mefenamic Acid on ST1A-Mediated Sulfations.
Recently, mefenamic acid has been shown to inhibit p-NP
sulfation in human livers (Vietri et al., 2000
). Therefore, the
influence of this chemical was assessed using recombinant ST1A forms
from human and experimental animal species (Table 8). Sulfating
activities toward all the chemicals (salicylamide, 6-hydroxymelatonin,
naringenin, harmol, and dopamine) of human ST1A3 and experimental
animal ST1A forms were decreased in the presence of 1 µM mefenamic
acid, although activities catalyzed by human ST1A5 were not altered in
the presence of 10 or 100 µM inhibitor. Extents of the inhibition at
10 µM mefenamic acid were largely consistent throughout the
substrates examined for each ST1A form (percentage of control
activities: ST1A3, 2.3-10%; ST1A1, 0.9-9.8%; St1a4, 5.8-16.3%;
and ST1A8, 49.7-74.1%, respectively). Activities of ST1A3, ST1A1, and
St1a4 were diminished to about 5 to 10% of controls in the presence of
10 µM mefenamic acid, whereas the ST1A8 activities remained 50 to
70% of the control.
| |
Discussion |
|---|
|
|
|---|
The present study using recombinant ST1A sulfotransferases has shown that all the experimental animal ST1A forms (rat ST1A1, mouse St1a4, and rabbit ST1A8) have substrate specificities similar to those of human ST1A3 compared with ST1A5. These forms exhibited substrate preferences for simple phenolic chemicals rather than for catecholamines (Tables 3 and 5). As shown in Table 4, experimental animal ST1A forms also showed substrate specificities comparable with human ST1A3 toward endogenous indoles. The activities catalyzed by human ST1A3 and experimental animal ST1A forms were decreased drastically in the presence of 10 µM mefenamic acid, but sulfating activities catalyzed by human ST1A5 were not inhibited by 100 µM mefenamic acid (Table 8). Hepatic contents were similar among human ST1A3 and experimental animal ST1A forms, whereas the content of human ST1A5 was about 19 times less than that of ST1A3 (Table 2).
|
To examine in detail the substrate specificities, apparent kinetic
parameters for p-NP, dopamine, and 6-HM were determined and
compared among these ST1A forms (Table 6). The
Km value of human ST1A3 for p-NP
was lower than that of human ST1A5 and the Km values for dopamine were opposite
between the two forms. Their values were largely consistent with those
previously reported (Veronese et al., 1994
; Lewis et al., 1996
; Fujita
et al., 1999b
). The ST1A forms from experimental animals also showed
low Km values for p-NP, and they
showed high Km values toward dopamine.
Thus, these data also support the functional similarity of experimental animal ST1A forms to human ST1A3.
Although the relationship between the structure and function remains
obscure, the residue 146 is proposed to be crucial in determining the
substrate specificity of both human ST1A3 and ST1A5 (Dajani et al.,
1998
). Corresponding positions of all experimental animal ST1A forms
are alanine as well as human ST1A3, whereas that of human ST1A5 is
glutamic acid (Fig. 2). A new ST1A form, ST1A8, has been isolated from
a male rabbit liver library and characterized in the present study. At
amino acid sequence level, ST1A8 is more related to the human ST1A
forms than equivalents in the other experimental animal species. Its
enzymatic properties were similar, but not identical with human ST1A3,
rat ST1A1, and mouse St1a4. For instance,
Km value of ST1A8 for dopamine was much
higher than that of human ST1A3, although
Km values for p-NP were nearly
the same between ST1A8 and ST1A3. In addition, the sulfating activities
of ST1A3, ST1A1, and St1a4 were inhibited about 90 to 95% in the
presence of 10 µM mefenamic acid, whereas those of ST1A8 were 30 to
50% inhibited (Table 8). The present study also shows first the
enzymatic properties of mouse St1a4. This form shared enzymatic
properties similar with rat ST1A1, but the gender difference pattern of
hepatic contents was opposite from ST1A1.
As shown in Table 7, experimental animal ST1A forms showed clear differences on enzymatic properties from human ST1A3 toward chemicals such as troglitazone and 4'-OH-PhIP. These results suggest that human ST1A3 has broader substrate specificities than experimental animal ST1A forms. Human ST1A3 showed higher activities toward estradiol and troglitazone than experimental animal ST1A forms. These data suggest that ST1A3 is able to catalyze the sulfation of the phenolic chemicals with large molecular sizes.
On the other hand, human ST1A5 exhibited substrate preferences for biogenic amines such as dopamine, norepinephrine, and normetanephrine. But toward 4-hydroxy-3-methoxyphenylglycol, a metabolite of normetanephrine by monoamine oxidase A, ST1A3, ST1A1, and St1a4 also showed similar activities. Moreover, the sulfating activity of ST1A5 toward 3,4-dihydroxyphenylacetic acid was lower than for the other ST1A forms. The amine residue of catecholamine is thus likely to affect the substrate specificities of ST1A5 strongly. In addition to catecholamines, ST1A5 catalyzed sulfations of harmol, 6-hydroxymelatonin, non-nitrogen-containing naringenin, and its derivative 5,7-dihydroxyflavanone effectively.
6-Sulfoxymelatonin is known to be a major urinary metabolite of
melatonin (Arendt et al., 1985
). All the ST1A forms showed low
Km and high
Vmax values for 6-hydroxymelatonin, which
suggests that these ST1A forms may contribute to an excretion of melatonin.
Toward HIAA, sulfating activities catalyzed by all ST1A forms were not detected. We also examined for 5-hydroxy-L-tryptophan, L-dopa, and salicylic acid, but sulfating activities toward these chemicals were not detected or very limited (data not shown). Thus, these data suggest phenolic chemicals having carboxyl group are not preferred substrates for ST1A forms.
Human ST1A3 and ST1A5 have been studied in the present study, although
another form, ST1A2, is known to express in human liver (Ozawa et al.,
1995
). ST1A2 shows similar enzymatic properties with ST1A3 and is a
minor form compared with ST1A3. Human ST1A3 mRNA was found to be the
major transcript form in the liver, representing 43 to 89% of the
three related ST1A mRNAs (Ozawa et al., 1998
).
The dog ST1A form (arbitrarily termed ST1A7) is reported to sulfate
both simple phenols such as p-NP and catecholamines such as
dopamine (Oddy et al., 1997
). It shows, however, low specificities toward tyramine and serotonin. Thus, the dog ST1A7 seems to be an
ortholog of human ST1A3 rather than ST1A5. In our preliminary examination, genomic Southern blot analysis using full-length St1a4
cDNA probe suggests a single gene copy of ST1A form in mice (data not
shown). Southern blot analysis of rat genomic DNA also indicates the
presence of a single gene (ST1A1 gene) copy per haploid
genome (Khan et al., 1993
). The present simultaneous comparison on
substrate specificities and hepatic contents indicates little functional similarity between human ST1A5 and experimental animal ST1A
forms. Distribution of human ST1A5 is mainly in extrahepatic tissues,
such as brain, platelet, and small intestine (Young et al., 1984
; Van
Loon and Weinshilboum, 1984
; Aksoy and Weinshilboum, 1995
).
Human plasma contains the highest concentration of catecholamines compared with those observed in most experimental animal species (Dousa
and Tyce, 1988
). These phenomena may imply the recent evolution of
ST1A5 in primates for response to high demands of the metabolism.
In conclusion, experimental animal (rat, mouse, and rabbit) ST1A forms showed substrate specificities similar to human ST1A3 rather than ST1A5 for several phenolic chemicals and thus they are likely to be ST1A3 orthologs functionally. These forms, however, showed enzymatic properties distinct from human ST1A3 on the sulfations of some chemicals such as troglitazone and 4'-OH-PhIP.
| |
Footnotes |
|---|
Received July 31, 2000; accepted October 10, 2000.
This study was supported in part by a grant-in-aid from the Ministry of Education, Science, and Culture and the Ministry of Health and Welfare, Japan, and from the Japan Health Sciences Foundation and Smoking Research Foundation.
2 The GenBank accession no. for the rabbit ST1A8 nucleotide sequence is AB029494.
Send reprint requests to: Prof. Yasushi Yamazoe, Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Aramaki-Aoba, Aoba-ku, Sendai 980-8578, Japan. E-mail: yamazoe{at}mail.cc.tohoku.ac.jp
| |
Abbreviations |
|---|
Abbreviations used are:
ST, cytosolic
sulfotransferase;
PAPS, 3'-phosphoadenosine-5'-phosphosulfate;
His-ST1A, recombinant ST1A protein that has 17 additional amino acid
residues at the N-terminal of
His-ST1A;
p-NP, p-nitrophenol;
4'-OH-PhIP, 2-amino-4'-hydroxy-1-methyl-6-phenylimidazo[4,5-b] pyridine, 3-OH-B[a]P,
3-hydroxybenzo[a]pyrene;
PAGE, polyacrylamide gel
electrophoresis;
PCR, polymerase chain reaction;
DMSO, dimethyl
sulfoxide;
HIAA, 5-hydroxyindoleacetic acid;
6-HM, 6-hydroxymelatonin;
HMC, 7-hydroxy-4-methylcoumarin (4-methylumbelliferone);
DHF, 5,7-dihydroxyflavanone.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Itaaho, M. H. Court, P. Uutela, R. Kostiainen, A. Radominska-Pandya, and M. Finel Dopamine Is a Low-Affinity and High-Specificity Substrate for the Human UDP-Glucuronosyltransferase 1A10 Drug Metab. Dispos., April 1, 2009; 37(4): 768 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Senggunprai, K. Yoshinari, M. Shimada, and Y. Yamazoe Involvement of ST1B Subfamily of Cytosolic Sulfotransferase in Kynurenine Metabolism to Form Natriuretic Xanthurenic Acid Sulfate J. Pharmacol. Exp. Ther., December 1, 2008; 327(3): 789 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Katoh, T. Matsui, H. Okumura, M. Nakajima, M. Nishimura, S. Naito, C. Tateno, K. Yoshizato, and T. Yokoi EXPRESSION OF HUMAN PHASE II ENZYMES IN CHIMERIC MICE WITH HUMANIZED LIVER Drug Metab. Dispos., September 1, 2005; 33(9): 1333 - 1340. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimada, R. Terazawa, Y. Kamiyama, W. Honma, K. Nagata, and Y. Yamazoe Unique Properties of a Renal Sulfotransferase, St1d1, in Dopamine Metabolism J. Pharmacol. Exp. Ther., August 1, 2004; 310(2): 808 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Maglich, J. Watson, P. J. McMillen, B. Goodwin, T. M. Willson, and J. T. Moore The Nuclear Receptor CAR Is a Regulator of Thyroid Hormone Metabolism during Caloric Restriction J. Biol. Chem., May 7, 2004; 279(19): 19832 - 19838. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Sheng, A. Saxena, and M. W. Duffel INFLUENCE OF PHENYLALANINES 77 AND 138 ON THE STEREOSPECIFICITY OF ARYL SULFOTRANSFERASE IV Drug Metab. Dispos., May 1, 2004; 32(5): 559 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Barnett, S. Tsvetanov, N. Gamage, J. L. Martin, R. G. Duggleby, and M. E. McManus Active Site Mutations and Substrate Inhibition in Human Sulfotransferase 1A1 and 1A3 J. Biol. Chem., April 30, 2004; 279(18): 18799 - 18805. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. U. Gamage, R. G. Duggleby, A. C. Barnett, M. Tresillian, C. F. Latham, N. E. Liyou, M. E. McManus, and J. L. Martin Structure of a Human Carcinogen-converting Enzyme, SULT1A1. STRUCTURAL AND KINETIC IMPLICATIONS OF SUBSTRATE INHIBITION J. Biol. Chem., February 21, 2003; 278(9): 7655 - 7662. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Duanmu, D. Locke, J. Smigelski, W. Wu, M. S. Dahn, C. N. Falany, T. A. Kocarek, and M. Runge-Morris Effects of Dexamethasone on Aryl (SULT1A1)- and Hydroxysteroid (SULT2A1)-Sulfotransferase Gene Expression in Primary Cultured Human Hepatocytes Drug Metab. Dispos., September 1, 2002; 30(9): 997 - 1004. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||