![]() |
|
|
Vol. 30, Issue 11, 1186-1193, November 2002
in Human
Intestinal Epithelial Cells (Caco-2) in Culture
Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, Canada
| |
Abstract |
|---|
|
|
|---|
The influence of pro-inflammatory cytokines on alpha class
glutathione S-transferase A1 and A2 (GSTA1/A2)
expression was examined in human colonic epithelial cells (Caco-2) in
culture. Dose-dependent reductions in GSTA1/A2 mRNA, protein, and
activity levels occurred in Caco-2 cells cultured in conditioned medium
(CM) from lipopolysaccharide-stimulated murine monocyte-macrophage
cells (RAW 264.7). Neutralizing anti-interleukin-1
(IL-1
)
antibodies attenuated this repression of GSTA1/A2 expression by CM.
Moreover, recombinant human IL-1
reduced GST
expression at the
mRNA, protein, and activity levels in a dose-related fashion. Reduction
of GSTA1/A2 mRNA levels by IL-1
was attenuated by pretreatment with
IL-1 receptor antagonist. GSTA1/A2 mRNA half-lives were similar in
control and IL-1
-treated cells, indicating that IL-1
has no
effect on mRNA stability. In reporter gene studies, IL-1
caused a
dose-related reduction of luciferase activity in Caco-2 cells transfected with the full-length GSTA1 promoter-luciferase construct. Using truncated constructs, IL-1
responsiveness was mapped to a
region 286 base pairs upstream to the coding region. Deletion of a
hepatic nuclear factor 1 (HNF-1) site in this region abrogated the
IL-1
-mediated repression of GSTA1 promoter activity. These results
demonstrate that IL-1
down-regulates GSTA1/A2 expression in cultured
human enterocytes by a transcriptional mechanism involving an HNF-1 site.
| |
Introduction |
|---|
|
|
|---|
Cellular
resistance to cytotoxicity is conferred by various detoxification and
antioxidant enzymes, including glutathione S-transferases
(GSTs1). GSTs plays an important role in
protecting colonic epithelial cells against the effects of dietary
mutagens and reactive oxygen species (Hayes and Pulford, 1995
).
Although the precise mechanisms are unclear, there is convincing
evidence that the pathogenesis of inflammatory bowel disease is
associated with increased oxidative damage due to a reduction in
cytoprotection (Lih-Brody et al., 1996
), including diminished GST
activity (Bhaskar et al., 1995
; Clapper and Szarka, 1998
).
Pro-inflammatory cytokines, notably tumor necrosis factor-
,
interleukin-1
, and interleukin-6 are secreted by inflammatory cells
and enterocytes during the intestinal inflammatory response (Stevens et
al., 1992
; Jung et al., 1995
). There is substantial evidence that
pro-inflammatory cytokines profoundly influence the constitutive
expression of a variety of genes, including drug-metabolizing enzymes
such as the cytochromes P450 (Ghezzi et al., 1986
; Bertini et al.,
1988
; Trautwein et al., 1992
). Relatively few studies, however, have
investigated the effects of cytokines on GST gene expression. In
cultured primary hepatocytes, the effects of cytokines on GST gene
expression are variable, resulting in either down-regulation (Adams and
Czuprynski, 1994
; Maheo et al., 1997
; Navasa et al., 1998
) or
up-regulation (Voss et al., 1996
), depending on the cytokine treatment.
There are no reports of the influence of cytokines on GST expression in
cultured human enterocytes.
The human alpha class GST isoenzymes consist of homodimers or
heterodimers of four major subunits (GSTA1, A2, A3, and A4) that are
involved in detoxification of dietary carcinogens (Huber et al., 1997
),
and organic hydroperoxides (Hayes and Pulford, 1995
). Induction of
GSTs, including those of the alpha class, by various structurally
unrelated electrophilic compounds and pro-oxidants, represents a major
mechanism of protection against oxidative and chemical stress. The
regulation of alpha class GSTs has been extensively studied in rodents,
and a complex set of regulatory elements has been characterized in the
5'-flanking regions, which control basal and xenobiotic inducible
expression (Daniel, 1993
; Hayes and Pulford, 1995
; Whalen and Boyer,
1998
). In rats, for example, transcription of the GSTA2 gene
is regulated through a "xenobiotic responsive element" that
mediates induction by planar aromatic compounds and an "antioxidant
responsive element", which mediates induction by phenolic
antioxidants and pro-oxidants (Rushmore and Pickett, 1990
; Daniel,
1993
; Whalen and Boyer, 1998
). A similar "electrophile responsive
element" has been identified in murine GSTA1 (Daniel,
1993
; Hayes and Pulford, 1995
; Whalen and Boyer, 1998
). Although the
5'-flanking regions of the human GSTA1 and GSTA2
genes are more than 95% homologous, they are very different from the
promoter for rat GSTA and lack a functional antioxidant
responsive element, suggesting that the mechanisms of transcriptional
regulation are different in the human and rodent genes (Suzuki et al.,
1994
).
GST
may have a particularly important cytoprotective role in the
colonic mucosa since elevated GST
levels contribute to increased
resistance in colorectal tumors, and increased GST
expression in
differentiated human enterocytes may protect against oxidative damage
(Vecchini et al., 1997
). However, GST
expression has not
specifically been assessed in patients with colitis or correlated with
cytokine levels in inflamed colon. We hypothesized that
pro-inflammatory cytokines may have a negative regulatory influence on
the expression of GST
in human enterocytes. We assessed the
influence of conditioned medium from LPS-activated macrophages and
various pro-inflammatory cytokines (IL-1
, IL-6, and TNF
) on the
expression of human GSTA1/A2 in Caco-2 cells. We present the first
evidence that IL-1
, a major pro-inflammatory cytokine secreted in
the inflamed colonic mucosa, down-regulates the expression of GSTA1/A2
in Caco-2 cells by a transcriptional mechanism involving a hepatic
nuclear factor 1 (HNF-1) site. Loss of GST
expression in human
enterocytes during colitis suggests that factors present in chronically
inflamed colonic mucosa could have important modulatory effects on
GST
-mediated cytoprotection.
| |
Materials and Methods |
|---|
|
|
|---|
Recombinant Cytokines and Chemicals.
Human recombinant IL-1
, IL-6, and TNF
were purchased from R & D
Systems (Minneapolis, MN). Human GSTA1/A2 cDNA was kindly provided by
Dr. C. P. Tu (Pennsylvania State University, University Park, PA).
The cDNA for mouse 7S was obtained from Dr. A. Balmain (Onyx
Pharmaceuticals, Richmond, CA). Antibodies against human alpha class
GST were obtained from Biotrin International (Dublin, Ireland). All
other compounds were readily available commercial products.
Culture and Treatment of Cells.
Caco-2 cells were selected for this study because this cell line
expresses high levels of alpha class GSTs and is highly suitable for
the study of the molecular mechanisms of GST regulation in human
enterocytes. Caco-2 cells were cultured under 5%
CO2 at 37°C in Dulbecco's modified Eagle's
medium supplemented with 10% (v/v) fetal bovine serum, and 100 µg/ml
of penicillin and streptomycin with medium changes every 2 days. For
the generation of conditioned medium (CM), murine monocyte-macrophage
cells (RAW 264.7) were stimulated for 24 h with LPS (100 ng/ml)
from Escherichia coli serotype 055:B5 (Sigma-Aldrich Canada
Ltd., Oakville, ON, Canada) dissolved in RPMI 1640 in the presence or
absence of 10% fetal bovine serum, denoted FBS+ or FBS
,
respectively. Conditioned media were then aspirated and frozen at
20°C until further use. Caco-2 cells were subsequently cultured in
Dulbecco's modified Eagle's medium diluted with CM for 24 h at
the following concentrations: 25%, 50%, and 100%. For experiments
involving neutralization of IL-1
, CM (FBS
) was preincubated with
two different concentrations (10 and 100 ng/ml) of anti-IL-1
polyclonal antibody (R & D Systems, Minneapolis, MN) for 1 h with
gentle rocking prior to exposure to Caco-2 cells. For Northern analysis
of GSTA1/A2 mRNA levels, Caco-2 cells were treated with various
concentrations of pro-inflammatory cytokines in the following ranges:
IL-1
(0.01-1.0 ng/ml); IL-6 (25-100 ng/ml), and TNF
(25-100
ng/ml) for 24 h. For receptor antagonist studies, Caco-2 cells
were preincubated with IL-1 receptor antagonist (IL-1ra) (800 ng/ml)
for 1 h before treatment with IL-1
(1 ng/ml) for 24 h,
after which total cellular RNA was collected. For studies of GSTA1/A2
mRNA stability, Caco-2 cells were treated with the polymerase II
inhibitor 5,6-dichloro-1
-ribofuranosyl-benzimidazole at a
concentration of 30 µg/ml in the presence or absence of IL-1
(1 ng/ml). Cells were then harvested and total cellular RNA was collected
at fixed time intervals (0, 1.5, 3, 6, 12, 24 h). For Western blot
analysis of GST
protein levels, the treatments were: IL-1
(0.01, 0.1, 1.0 ng/ml) and CM (25, 50, and 100%).
RNA Isolation and Northern Blot Analysis.
Total RNA from cells was isolated using the TRIzol reagent method
(Invitrogen, Carlsbad, CA). Northern blot analysis was performed with the extracted RNA as detailed previously (Benn et al., 1999
). The
blots were probed with
-32P-labeled cDNA for
GSTA1 (808 bp) (Tu and Qian, 1986
), which hybridizes with both A1 and
A2 subunits and with a cDNA probe for the cytoplasmic RNA 7S as an
internal load control. For quantitation of genes, phosphorimaging (GS-250 Molecular Imager; Bio-Rad Laboratories, Mississauga, ON, Canada) was used, and the intensity of the resultant bands was assessed by densitometry using Molecular Analyst software (Version 2.1; Bio-Rad Laboratories). Gene expression data were calculated by first normalizing for 7S, and values were expressed as a
percentage of controls.
Plasmid Construction. A LUC reporter gene plasmid construct containing the entire 5'-flanking region of the GSTA1 gene and various truncated constructs were prepared by polymerase chain reaction (PCR) with the following specific oligonucleotide primers (the length of the resultant PCR product from the transcriptional start site is indicated in parentheses):
Sense primer 1: (
1614 bp) GAACTCGAGTTTCCAAACTCCCCATAAATTTTC
Sense primer 2: (
1195 bp) TAGCTCGAGGGGGCTCTTGGCCTTT
Sense primer 3: (
590 bp) TGCCTCGAGGGTCTCTTGATTTGTCAGA
Sense primer 4: (
286 bp) GAACTCGAGCATCTTTAAAAAGCCAGTTTC
Antisense primer: TTTAAGCTTCGCTGTCACCGTCCTGGCTCG
The PCR reaction was performed using genomic DNA extracted from human
peripheral blood lymphocytes as a template as previously described
(Gilmore et al., 2001
1614 LUC,
1195 LUC,
590 LUC, and
286 LUC according to the length of the 5'-UTR insert. The
cytomegalovirus
-galactosidase reporter gene was used for
normalizing the transient transfection.
Site-Directed Mutagenesis.
Activator protein 1 (AP-1) (CGTCTTCT;
886-779) and AP-2 (ACCCGGGCA;
1171-1163) sites were deleted from
1614 LUC and
1195 LUC,
respectively, and an HNF-1 (GGAACACATTAAC;
182-170) site was deleted
from
286 LUC by site-directed mutagenesis using a two-stage PCR
protocol as described (Wang and Malcolm, 1999
). The following
oligonucleotide primers were designed to span and delete these
consensus sequences:
AP-1 LUC,
AP-2 LUC, and
HNF-1 LUC.
Transfection and Luciferase Assay.
Twenty-four hours after reaching confluence, Caco-2 cells (2 × 105/35-mm dish) were transfected with a DNA
mixture containing 2.5 µg/ml GST-LUC reporter plasmid and 1 µg/ml
-gal plasmid using LipofectAMINE (Invitrogen) according to the
manufacturer's recommendations. After 24 h, medium containing
IL-1
at the indicated concentrations was added. Twenty-four hours
later, cells were harvested and washed twice with phosphate-buffered
saline, cell extracts were prepared, and aliquots of the lysates were
assayed for luciferase and
-galactosidase enzyme activities as
described (Brasier et al., 1989
). Luciferase activities were normalized
to
- galactosidase activity to correct for differences in
transfection efficiency. The plasmid, pSV40-Luc, in which the
LUC gene is under the control of a SV40 promoter and
enhancer, and the promoterless plasmid pLuc-0 served as positive and
negative controls, respectively. All transfection studies were repeated
at least three times.
SDS-PAGE and Western Blot Analysis.
Alpha class GST protein was identified by Western blot analysis as
previously described (Kirby et al., 1993
). Briefly, protein (50 µg)
from cell extracts was separated by SDS-PAGE on a 12% polyacrylamide
gel, transferred to nitrocellulose, and incubated for 2 h with
rabbit anti-human GST
polyclonal antibody diluted to 1:500. After
incubation with goat anti-rabbit peroxidase secondary antibody (Vector
Laboratories, Burlington, ON, Canada), bands on blots were detected by
chemiluminescence (ECL; Amersham Biosciences, Piscataway, NJ) and
visualized by autoradiography. The relative concentration of GST
protein levels was then determined by densitometry. Three independent
experiments were performed, and Western blots are presented from one
representative experiment.
GST Activity.
GST
has high substrate specificity toward cumene hydroperoxide
(Hayes and Pulford, 1995
). Catalytic activity toward cumene hydroperoxide (CuOOH) was measured in extracts of Caco-2 cells using
modifications of a method described by Habig et al. (1974)
. Reactions
were performed in 0.1 M potassium phosphate (pH 7.0) at 25°C in a
total volume of 1 ml. Cell extracts (400 µg) were incubated with
CuOOH (1.5 mM), GSH (1 mM), NADPH (0.1 mM), and glutathione reductase
(0.3 unit), and the time-dependent disappearance of NADPH was monitored
at 340 nm with
= 6.2 mM
1
cm
1. Protein concentration was estimated by the
Bradford method (Bradford, 1976
). Specific activities were
standardized to protein and expressed as nanomoles per minute per milligram.
Statistical Analysis. Data are presented as mean ± S.D. Groups of data were compared by one-way analysis of variance and, if significant, were further evaluated by Fisher's least significant difference test. Significance was established at p values <0.05.
| |
Results |
|---|
|
|
|---|
Effect of CM from LPS-Stimulated Macrophages on GSTA1/A2 mRNA
Levels.
Previous studies have shown, by reverse transcription-PCR analysis and
cytokine bioassays, that LPS stimulation of the murine monocyte-macrophage cell line (RAW 264.7) results in increased mRNA
levels and bioactivities of IL-1
, IL-6, and TNF
(Adams and
Czuprynski, 1994
). A similar study revealed, by Northern blot analysis,
that levels of IL-1
mRNA were 4-fold higher in RAW 264.7 cells stimulated with LPS in the complete absence of FBS compared with
mRNA levels in the presence of 2% FBS (Perera et al., 1998
). To
determine whether pro-inflammatory cytokine(s) in CM from LPS-activated
macrophages affect GSTA1/A2 mRNA levels in Caco-2 cells and to
determine which cytokine may contribute to an effect, we compared
GSTA1/A2 mRNA levels in Caco-2 cells incubated with CM that was either
FBS+ or FBS
. Increasing concentrations of CM (25, 50, and 100%)
resulted in reductions in GSTA1/A2 mRNA levels that were significantly
greater in cells incubated with FBS
CM (reductions of 30, 40, and
49%) (p < 0.05) compared with cells cultured
in FBS+ CM (reductions of 3, 15, and 18%) (Fig. 1). Treatment of Caco-2 cells with LPS
alone (50 ng/ml) had no effect on GSTA1/A2 mRNA levels (data not
shown).
|
Effect of CM on GST
Protein Levels and Catalytic Activity.
To determine whether CM effects also occur at the protein level, we
determined GST
protein levels in cell extracts of Caco-2 cells
cultured in various concentrations of FBS
CM by Western blot
analysis. Polyclonal antibodies recognized a single 25-kDa band
representing human GST
protein. Exposure of Caco-2 cells to FBS
CM
(25, 50, and 100%) for 24 h resulted in a dose-related reduction
in GST
protein levels to 65, 54, and 50% of control values,
respectively (Fig. 2, A and B). The
influence of CM on GST activity toward the alpha class substrate cumene
hydroperoxide (CuOOH) was also assessed in cell extracts from Caco-2
cells (Fig. 2C). GSTA1/A2 activity was reduced to approximately
58% and 55% (p < 0.05) of control values
following exposure to 50% and 100% CM, respectively (Fig. 2C).
|
present in CM is responsible for reducing
GSTA1/A2 protein levels, we preincubated CM (FBS
) with neutralizing
anti-IL-1
antibody at two different concentrations (10 and 100 ng/ml). Preincubation with anti-IL-1
antibody resulted in
dose-related abrogation of the ability of CM to reduce GST
protein
levels (Fig. 3).
|
Effect of IL-1
on GSTA1/A2 mRNA Levels.
To confirm the role of IL-
in down-regulating GSTA1/A2 expression
and to rule out a regulatory role for IL-6 and TNF
, we examined the
effect of various concentrations of these pro-inflammatory cytokines on
GSTA1/A2 mRNA levels in Caco-2 cells treated for 24 h. Northern
analysis revealed that treatment with IL-1
resulted in
dose-dependent reductions in GSTA1/A2 mRNA levels that were significantly different from controls (Fig.
4), whereas treatment with IL-6 and
TNF
had no effect (data not shown).
|
, Caco-2 cells were
preincubated with 800 ng/ml IL-1ra for 1 h before treatment with
IL-1
(1 ng/ml) for 24 h, and GSTA1/A2 mRNA levels were
assessed by Northern analysis (Fig. 5).
IL-1ra pretreatment significantly inhibited IL-1
-mediated reduction
in GSTA1/A2 mRNA levels (IL-1
alone, 30% of control versus IL-1ra + IL-1
, 59% of control, p < 0.05). GSTA1/A2 mRNA
levels in cells treated with IL-1ra alone were not significantly
different from controls.
|
Effect of IL-1
on GST
Protein Levels and Catalytic Activity.
GST
expression was significantly reduced by IL-1
to a maximum of
approximately 50% of control values at a dose of 0.1 ng/ml (p < 0.05; Fig.
6, A and B) and was not altered further
at concentrations as high as 50 ng/ml (data not shown).
IL-1
-mediated reductions in GST
expression were also reflected at
the level of catalytic activity where a maximal reduction of 50% was
observed at a dose of 0.1 ng/ml (Fig. 6C). Treatment of another human
enterocyte cell line (HT-29) with IL-1
(10 ng/ml) also resulted in a
40% reduction in GST
protein levels (data not shown).
|
Effect of IL-1
on GSTA1/A2 mRNA Stability.
To determine whether changes in mRNA stability contributed to the
altered expression of GSTA1/A2 in IL-1
-treated Caco-2, mRNA decay
experiments were performed. Northern analysis revealed similar
half-life values of GSTA1/A2 mRNA in control (16.5 h) and
IL-1
-treated cells (17.1 h). This experiment was repeated twice with
similar results.
Effect of IL-1
on Transcriptional Regulation of the
GSTA1 Gene.
To locate the regulatory element within the GSTA1 promoter region that
is responsible for the decrease in gene expression by IL-1
,
luciferase activities were determined in IL-1
-treated and untreated
cells transfected with various truncated or deleted constructs (Fig.
7A). A clear dose-dependent decrease in
LUC activity was observed in cells transfected with
1614 LUC that
were subsequently treated with increasing concentrations of IL-1
(Fig. 7A), thereby paralleling the effects on GSTA1 mRNA levels in
Caco-2 cells. A 60% decrease in luciferase activity occurred with an
IL-1
concentration of 1 ng/ml which was not reduced further with
concentrations as high as 50 ng/ml (data not shown). Because of the
role of AP-1, AP-2, and HNF-1 sites in mediating IL-1
effects on
gene transcription, these sites were targeted for deletion by
site-directed mutagenesis. IL-1
caused a significant reduction in
luciferase activity in all truncated constructs to a maximal reduction
of 80% of untreated controls observed with the
286 LUC construct
(p < 0.01; Fig. 7C), suggesting that this
region contains a sequence that is negatively regulated by IL-1
.
Deletions of AP-1 and AP-2 sites from
1614 LUC and
1195 LUC had no
effect on IL-1
responsiveness. However, deletion of the HNF-1 site
from the
286 LUC abrogated the IL-1
effect, suggesting that HNF-1
is the key site for IL-1 repression of GSTA1 gene
expression.
|
| |
Discussion |
|---|
|
|
|---|
The regulation of GST gene expression by inflammatory
cytokines has profound biological implications, particularly in tissues such as the colonic epithelium, where GSTs play a critical
cytoprotective role against electrophilic metabolites of xenobiotics
and lipid peroxidation. Whereas cytokine-mediated down-regulation of
cytochromes P450 has been well documented, relatively limited attention
has been focused on the detailed regulatory mechanisms of GST
isoenzymes by cytokines, and no studies have been conducted in cultured
human enterocytes. The results of the present study provide the first evidence of marked down-regulation of human GSTA1/A2 in Caco-2 cells by
the pro-inflammatory cytokine IL-1
. This IL-1
-mediated down-regulation occurs at the level of transcription and involves an
HNF-1 response element.
Our finding of reduced GSTA1/A2 mRNA, protein, and catalytic activity
in Caco-2 cells exposed to CM from LPS-stimulated macrophages suggests
that products of activated phagocytic cells, notably pro-inflammatory
cytokines, are important regulators of alpha class GSTs in human
enterocytes. Previous studies have shown that exposure of cultured
mouse macrophages to LPS results in the production of various
pro-inflammatory cytokines including IL-1
, IL-6, and TNF
(Adams
and Czuprynski, 1994
). Moreover, IL-1
transcript levels are much
higher in LPS-stimulated macrophages cultured in the absence of serum
(Perera et al., 1998
). In this regard, our finding of marked reduction
in GSTA1/A2 mRNA levels in Caco-2 cells exposed to serum-free CM
suggests involvement of IL-1
in GSTA1/A2 down-regulation. The
repressive role of IL-1
was further established when the effects of
CM on GSTA1/A2 expression were attenuated with anti-IL-1
neutralizing antibodies. Furthermore, dose-related reduction of
GSTA1/A2 mRNA, protein, and activity levels in Caco-2 cells by human
recombinant IL-1
indicates that this cytokine is an important
repressor of GST
expression. Finally, we demonstrated that effects
of IL-1
on GSTA1/A2 expression are mediated via the IL-1
receptor
since pretreatment of Caco-2 cells with IL-1ra significantly inhibited
repression of transcription by IL-1
.
To date, three studies have examined the influence of cytokines on the
expression of GST isoenzymes, all of which have been conducted in
hepatocytes in primary culture (Langouet et al., 1995
; Voss et al.,
1996
; Maheo et al., 1997
). In rat hepatocytes IL-1
resulted in
down-regulation of rGSTA2 and M1 due to mRNA destabilization rather
than altered rates of gene transcription. Our finding of
IL-1
-mediated reduction of LUC reporter activity indicates that
IL-1
decreases GSTA1 transcription. Moreover, we have excluded the
involvement of post-transcriptional events since IL-1
treatment does
not alter GSTA1/A2 mRNA half-life in RNA decay experiments. Both
positive and negative regulatory regions have been identified in the
GSTA1 promoter, including several transcription factor recognition
sites such as AP-1, AP-2, HNF-1, a glucocorticoid-responsive element,
and several, as yet uncharacterized, negative regulatory and enhancer
elements (Suzuki et al., 1994
; Lorper et al., 1996
; Whalen and Boyer,
1998
). Although few functional assays have been performed, there is
accumulating evidence to suggest that AP-1 sites may play a role in the
regulation of GSTA1 and GSTA2. For example, a study of human
hepatocytes recently demonstrated that induction of GSTA1 and GSTA2 by
IL-4 paralleled an increase in AP-1 binding activity (Langouet et al.,
1995
). In mice, up-regulation of GSTA1 by oxidants and phenolic
antioxidants occurs via dual AP-1-like sites present in the
electrophile-responsive element (Friling et al., 1992
). Moreover, it
has been demonstrated that the negative influence of IL-1
on
microsomal triglyceride transfer protein is mediated via AP-1 and HNF-1
sites (Navasa et al., 1998
). For these reasons, we decided to rule out
the involvement of AP-1, AP-2, and HNF-1 in IL-1
-mediated
down-regulation of GSTA1. We eliminated the involvement of AP-1 and
AP-2 binding sequences in IL-1
-mediated effects since deletion of
these sites in luciferase reporter constructs did not alter IL-1
responsiveness. Further mapping of the GSTA1 promoter region with
progressive 5' deletion constructs localized the IL-1
-responsive
region to a sequence within a region 286 bp upstream to the
transcriptional start site. This region of the promoter contains an
HNF-1 site the deletion of which abrogated IL-1
effects in reporter
assays. In the liver, HNF-1 levels are reduced during inflammatory
responses (Burke et al., 1994
), and numerous genes that contain
functional HNF-1 binding sequences are down-regulated under these
conditions (Memon et al., 2001
). Our findings are supported by results
of reporter assays that have shown that binding of HNF-1 to its
consensus sequence in the 5'-flanking region of human GSTA2 increases
promoter activity (Klone et al., 1990
; Clairmont et al., 1994
). The
possibility that other factors induced by IL-1
may bind to the HNF-1
site and down-regulate GSTA1/A2 remains to be investigated.
IL-1
plays a central role in the development of inflammatory bowel
disease (IBD) (Dinarello, 1994
). Studies in animal models of colitis
(Rachmilewitz et al., 1989
) and in human patients with IBD have shown
that enhanced production of IL-1
correlates with the degree of
mucosal inflammation and necrosis (Ligumsky et al., 1990
). The
importance of IL-1ra in limiting the clinical severity of IBD has been
demonstrated in rodent models of colitis (Cominelli et al., 1990
) as
well as in human patients (Casini-Raggi et al., 1995
). Thus, the
balance between IL-1
and IL-1ra may play a critical role in host
defenses to mucosal inflammation. It is unclear whether the
relationship of IL-1
tissue levels and the degree of mucosal inflammation and necrosis during IBD can be attributed to lack of
GST-mediated defense since correlative studies have not yet been
performed. However, studies of colonic mucosal antioxidant enzymes in
patients with IBD and in animal models of colitis have revealed
significant reductions in total glutathione S-transferase activity (Bhaskar et al., 1995
; Clapper et al., 1999
) and superoxide dismutase activity (Lih-Brody et al., 1996
), indicating that
antioxidant defenses are compromised during colitis.
In conclusion, we have shown that exposure of cultured human
enterocytes to the pro-inflammatory cytokine IL-1
markedly
down-regulates the expression of alpha class GSTs in culture by a
transcriptional mechanism. We have delineated a region
286 bp
upstream to the coding region through which IL-1
reduces GSTA1
transcriptional activity and have implicated an HNF-1 site in this
down-regulation. We have also shown that expression of GSTA1/A2
transcripts is reduced by human recombinant IL-1
and secretion of
this cytokine by activated mouse macrophages. Further studies are
required to fully elucidate the detailed regulatory mechanisms and the
biological implications of down-regulation of alpha class GSTs during colitis.
| |
Footnotes |
|---|
Received May 29, 2002; accepted August 2, 2002.
Supported by funding from the Medical Research Council of Canada (Grant MT-13757).
Address correspondence to: Dr. Gordon M. Kirby, Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, Canada, N1G 2W1. E-mail: gkirby{at}uoguelph.ca
| |
Abbreviations |
|---|
Abbreviations used are:
GST, glutathione
S-transferase;
IL-1
, interleukin-1
;
IL-6, interleukin-6;
TNF
, tumor necrosis factor-
;
GSTA1/A2, alpha class
glutathione S-transferase A1 and A2;
HNF-1, hepatic
nuclear factor-1;
CM, conditioned medium;
LPS, lipopolysaccharide;
FBS, fetal bovine serum;
IL-1ra, interleukin-1 receptor antagonist;
bp, base pair(s);
LUC, luciferase;
PCR, polymerase chain reaction;
AP-1, activating protein-1;
IBD, inflammatory bowel disease.
| |
References |
|---|
|
|
|---|
biomarkers of cancer risk and chemopreventive response.
Chem-Biol Interact
112:
377-388[CrossRef].
enhanced production during active disease.
Gut
31:
686-689This article has been cited by other articles:
![]() |
R. I. Dmitrieva, C. A. Hinojos, E. Boerwinkle, M. C. Braun, M. Fornage, and P. A. Doris Hepatocyte Nuclear Factor 1 and Hypertensive Nephropathy Hypertension, June 1, 2008; 51(6): 1583 - 1589. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Onica, K. Nichols, M. Larin, L. Ng, A. Maslen, Z. Dvorak, J.-M. Pascussi, M.-J. Vilarem, P. Maurel, and G. M. Kirby Dexamethasone-Mediated Up-Regulation of Human CYP2A6 Involves the Glucocorticoid Receptor and Increased Binding of Hepatic Nuclear Factor 4{alpha} to the Proximal Promoter Mol. Pharmacol., February 1, 2008; 73(2): 451 - 460. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ng, K. Nichols, K. O'Rourke, A. Maslen, and G. M. Kirby Repression of Human GSTA1 by Interleukin-1beta Is Mediated by Variant Hepatic Nuclear Factor-1C Mol. Pharmacol., January 1, 2007; 71(1): 201 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Romero, L. Ng, and G. M. Kirby Chemical Inducers of Rodent Glutathione S-Transferases Down-Regulate Human GSTA1 Transcription through a Mechanism Involving Variant Hepatic Nuclear Factor 1-C Mol. Pharmacol., July 1, 2006; 70(1): 277 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ping, H. Wang, M. Huang, and Z.-s. Liu Genetic Analysis of Glutathione S-transferase A1 Polymorphism in the Chinese Population and the Influence of Genotype on Enzymatic Properties Toxicol. Sci., February 1, 2006; 89(2): 438 - 443. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||