Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

Aromatic hydrocarbons (AHs¹) are ubiquitous environmental contaminants formed as byproducts of industrial chemical or combustion processes. This group includes halogenated AHs such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and polycyclic AHs such as 3-methylcholanthrene (MC). TCDD is the prototypic AH and is a well characterized potent toxicant in experimental animals. The toxic and biological effects of TCDD are mediated via the aromatic hydrocarbon receptor (AHR), which belongs to the family of basic-helix-loop-helix-PAS (PER-ARNT-SIM) proteins. The AHR acts as a ligand-activated transcription factor, and our understanding of its function derives mainly from studies of the transcriptional up-regulation of cytochrome P450 (E.C.1.14.14.1) genes such as CYP1A1 by TCDD (reviewed in Whitlock, 1999). Briefly, the AHR binds ligand in the cytoplasm and is translocated to the nucleus. The activated DNA-binding form is a heterodimer, which consists of the AHR and the AHR nuclear translocator (ARNT). The complex binds specific DNA sequences known as dioxin-responsive elements (DREs), located in the 5'-flanking sequence of CYP1A1 and other target genes such as CYP1A2 and CYP1B1. The bound AHR complex causes a change in chromatin structure, making the promoter region more accessible to transcription factors and leading to an increase in the rate of transcription of the gene.

TCDD also down-regulates expression of several genes (reviewed in Safe, 1995) including the estrogen receptor, transforming growth factor-₂, pS2 (Gillesby et al., 1997), cathepsin D (Krishnan et al., 1995), and CYP2C11. The mechanisms of gene suppression are only partially understood.

CYP2C11 is the predominant cytochrome P450 enzyme expressed constitutively in the liver of adult male rats. Administration of AHs to adult male rats causes down-regulation of CYP2C11 at the catalytic activity, protein, and mRNA levels (Yeowell et al., 1987; Shimada et al., 1989; Jones and Riddick, 1996). This down-regulation is at least partly mediated at the transcriptional level (Lee and Riddick, 2000) and structure-activity relationships suggest a role for the AHR (Safa et al., 1997). Since most transcriptional changes mediated by the AHR occur via interactions with 5'-flanking DRE-like sequences, we have studied the 5'-flanking region of CYP2C11 to understand the mechanism by which AHs down-regulate the gene.

In the context of the CYP1A1 gene, DRE sequences function as transcriptional enhancers; however, DRE-like sequences are also implicated in gene suppression in the context of the pS2 (Gillesby et al., 1997), cathepsin D (Krishnan et al., 1995), human B lymphocyte cell surface marker CD19 (Masten and Shiverick, 1995), and c-fos (Duan et al., 1999) genes. In each case, the DRE-like sequence contains the four invariant core nucleotides required for AHR binding [5'-GCGTGNN(A/T)NNN(C/G)-3'] (Yao and Denison, 1992) but contains one or more mismatches with the consensus sequence for functional enhancer activity [5'-(T/G)NGCGTG (A/C)(G/C)A-3'] (Lusska et al., 1993). Binding of the AHR to these "inhibitory DREs" is thought to interfere with the binding of other positive trans-acting factors to nearby response elements, thus resulting in down-regulation of gene expression.

Our overall aim is to understand the molecular mechanisms by which AHs down-regulate CYP2C11 expression, as a model for negative transcriptional regulation of gene expression by xenobiotics. In the present work, we showed that TCDD suppresses CYP2C11 mRNA in primary rat hepatocytes without altering the mRNA half-life. We identified five DRE-like sequences in the CYP2C11 5'-flank and showed that at least one of these is capable of binding the AHR with high affinity. In vitro DNase I footprinting was used to examine changes caused by AH treatment on protein binding in the 5'-flanking and promoter regions of the CYP2C11 gene. Luciferase reporter gene assays in transfected continuous cell lines and primary rat hepatocytes were used to study the functional role of the CYP2C11 5'-flanking region in the suppressive response to AHs. Our results suggest that AHs down-regulate CYP2C11 by a transcriptional response that is not simply due to AHR binding to an identified DRE-like sequence.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

Electrophoretic Gel Retardation Assay. Cytosol was prepared from confluent cultures of the mouse hepatoma cell line Hepa-1c1c7 (Hepa-1) by differential centrifugation. The following pairs of complementary DNA oligonucleotides were used, with the four invariant core DRE nucleotides underlined (differences from the binding consensus sequence are shown in lower case, and positions in the CYP2C11 gene are shown relative to the transcription start site, +1): the Cyp1a1 (WT)-DRE containing the functional AHR-binding site of DRE3 from the mouse Cyp1a1 5'-flank (5'-GATCCGGAGTTGCGTGAGAAGAGCCA-3' and 5'-GATCTGGCTCTTCTCACGCAACTCCG-3'); the MUT-DRE containing a mutation in one of the four invariant core nucleotides (bold) (5'-GATCCGGAGTTGCtTGAGAAGAGCCA-3' and 5'-GATCTGGCTCTTCTCAaGCAACTCCG-3'); CYP2C11-DRE1 [5'-GATCC(1610)TGGCTCaCGTG GCcCCGGAA(1629)A-3' and 5'-GATCT(1629)TTCCGGgGCCACGtGAGC CA(1610)G-3']; CYP2C11-DRE2 [5'-GATCC(1595)ATGCGAcCGTGGCT GTGGCT(1614)A-3' and 5'-GATCT(1614)AGCCACAGCCACGgTCG CAT(1595)G-3']; CYP2C11-DRE3 [5'-GATCC(1539)GTAATTGCGTGCCT CCAGCA(1558)A-3' and 5'-GATCT(1558)TGCTGGAGGCACGCAATTAC (1539)G-3']; CYP2C11-DRE4 [5'-GATCC(1392)ATTGACaCGTGTCTGC TGGC(1411)A-3' and 5'-GATCT(1411)GCCAGCAGACACGtGTCAAT (1392)G-3']; CYP2C11-DRE5 [5'-GATCC(1407)GCAGACaCGTGTCAAT GCAG(1388)A-3' and 5'-GATCT(1388)CTGCATTGACACGtGTC TGC(1407)G-3']. Complementary pairs of oligonucleotides were annealed and used as unlabeled competitor DREs; (WT)-DRE was end-labeled with [-³²P]ATP using T4 polynucleotide kinase. Hepa-1 cytosol (80 µg of protein) was incubated with the vehicle DMSO or TCDD (20 nM) for 2 h at room temperature. The gel retardation assay was performed as described by Riddick et al. (1994) using 375 ng poly[d(I-C)], ~100,000 cpm (0.25-0.8 ng) ³²P-labeled (WT)-DRE, and 50 mM NaCl. Protein-DNA complexes were analyzed by electrophoresis on nondenaturing 4% polyacrylamide gels. Relative quantitation of AHR-DRE binding was performed by phosphorimaging analysis using IPLab Gel software (Signal Analytics, Vienna, VA). .

Reporter Gene Constructs. The following plasmids from Promega (Madison, WI) were used as controls: pGL3-Basic (promoterless), pGL3-Promoter (SV40 promoter), and pGL3-Control (SV40 promoter and enhancer); pSV--galactosidase or pRL-TK (Renilla luciferase) were used to normalize for transfection efficiency. The plasmid pGEM 2.3-kb (Strom et al., 1994) contained the CYP2C11 5'-flank and promoter (2390/+26); the plasmid pGudluc 1.1 (Garrison et al., 1996) contained the luciferase gene driven by the mouse mammary tumor virus promoter under regulation of a 480-bp fragment from the mouse Cyp1a1 5'-flank containing four DREs. To generate a reporter construct containing the entire known CYP2C11 5'-flank and promoter, the plasmid pGEM 2.3-kb was digested with SalI and NcoI and the CYP2C11 5'-fragment (2390 to + 21) was ligated into pGL3-Basic digested with XhoI and NcoI to generate (2390-2C11)-pGL3. The construct (1311-2C11)-pGL3 (containing 1311 to + 21) was made by digesting (2390-2C11)-pGL3 with HindIII and NcoI and then ligating the resulting 1332-bp fragment into the pGL3-Basic vector digested with the same enzymes. The construct (196-2C11)-pGL3 (containing 196 to + 21) was generated using Sprague-Dawley rat genomic DNA as a template for PCR amplification of a fragment (196 to + 152) of the CYP2C11 gene. The PCR product was digested with MluI and NcoI and ligated into the pGL3-Basic vector digested with the same enzymes. To generate 2C11-(pGL3-Promoter), pGEM 2.3-kb was used as a template for PCR amplification of a fragment (1935 to 101) of the CYP2C11 5'-flanking region. The PCR product was digested with MluI and BglII and ligated into pGL3-Promoter digested with the same enzymes.

Transient Transfection of Continuous Cell Lines and Luciferase Assay. Cultures of Hepa-1, Buffalo rat liver BRL 5637, and human hepatocellular carcinoma HepG2 cells were cotransfected with luciferase plasmids (3.5 µg for Hepa-1, 2.5 µg for BRL 5637, 4 µg for HepG2) and the pSV--galactosidase plasmid (2.5 µg for Hepa-1, 2 µg for BRL 5637, 2 µg for HepG2) with Superfect reagent QIAGEN (Valencia, CA) according to manufacturer's instructions. Twenty-four hours after transfection, cells were treated with TCDD or DMSO vehicle for 24 h. Cell extract (50 µl) was mixed with 100 µl of luciferase assay reagent (Promega), and luciferase activity was measured with a TD-20/20 luminometer (Turner Designs, Inc., Sunnyvale, CA). -Galactosidase activity of cell extracts was measured spectrophotometrically.

Hepatocyte Isolation, Culture, and Transfection. Male Fischer 344 rats (9-10 weeks of age; Harlan) were cared for in accordance with the principles of the Canadian Council on Animal Care. Hepatocytes were isolated by nonrecirculating in situ collagenase perfusion through the portal vein (Liddle et al., 1992; Safa et al., 1997). Cells were plated on 60-mm culture dishes coated with 0.2 ml of matrigel (7.5 mg/ml; Collaborative Biomedical Products, Bedford, MA). Medium was changed 4 h after plating and every 48 h thereafter.

DNaseI Footprinting. Rats received a single i.p. injection of MC (40 mg/kg) or corn oil vehicle 6 h before euthanasia. Nuclear extracts were prepared from rat liver according to the method of Gorski et al. (1986). Hepatic RNA was isolated and RT-PCR analysis performed as described above, using 0.2 µM CYP1A1 or -actin primers, 1.5 mM MgCl₂, 0.2 mM dNTPs, and input cDNA derived from 125 ng RNA. Primers for CYP1A1 were as follows: forward, 5'-ACGTTATGACCACGATGACC-3' and reverse, 5'-CTTGGCTCTGTGAAGGAAGG-3', and cycling conditions were 94°C for 20 s, 52°C for 20 s, 72°C for 40 s, 17 cycles; primers for -actin were as follows: forward, 5'-ACCGTGAAAAGATGACCCAG-3' and reverse, 5'-GAGCCACCAATCCACACAG-3', and cycling conditions were 94°C for 20 s, 51°C for 20 s, 72°C for 40 s, 18 cycles (Franc et al., 2001).

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

The role of the AHR in mediating induction of CYP1A1 and other genes in response to AHs is well established. AHs also suppress several genes, but the mechanisms are not understood, and the role of the AHR remains controversial. In vivo administration of AHs to rats causes down-regulation of CYP2C11 via a transcriptional mechanism (Jones and Riddick, 1996; Lee and Riddick, 2000), and our structure-activity relationship study implicated the AHR in this response (Safa et al., 1997). To further our understanding of this down-regulation, we have now conducted molecular mechanistic investigations of the CYP2C11 5'-flanking region.

Primary rat hepatocytes cultured on matrigel for 5 to 7 days show relatively stable CYP2C11 expression (Liddle et al., 1992); AH treatment decreases CYP2C11 protein expression in this hepatocyte culture system (Safa et al., 1997). Using the same culture system, we found that TCDD caused an approximately 30% suppression of CYP2C11 mRNA expression (Fig. 1A). IL-1, a well characterized suppressor of CYP2C11 (Iber et al., 2000), decreased CYP2C11 mRNA by approximately 70% (Fig. 1A). Following treatment of hepatocytes with the transcriptional inhibitor 5,6-dichlorobenzimidazole riboside (DRB), RT-PCR analysis showed that the half-life of CYP2C11 mRNA was 16 h, and this was not altered by TCDD treatment (Fig. 1B). In the same RT-PCR reactions, the half-life of -tubulin mRNA was determined to be 9 h and also not affected by TCDD treatment (Fig. 1B); hence, -tubulin was not used to normalize CYP2C11 levels. 18S rRNA levels were confirmed to be similar for all samples (data not shown).

View larger version (22K): [in this window] [in a new window]   Fig. 1.   Effect of TCDD and IL-1 on CYP2C11 mRNA levels and effect of TCDD on CYP2C11 mRNA half-life in rat hepatocytes. A, hepatocytes cultured on matrigel for 5 days were treated with 10 nM TCDD or 7.5 ng/ml IL-1 for 24 h. Total RNA was prepared and used for RT-PCR analysis. CYP2C11 signal was normalized to the internal standard -tubulin. Data are presented as a percentage of the mean for the vehicle controls and expressed as the mean ± S.D. of three or four independent determinations. *, significantly different (p  0.05) from PBS/BSA control; **, significantly different (p  0.01) from DMSO control, based on Student's t test. B, hepatocytes were cultured on matrigel for 4 days and then pretreated with DMSO or 10 nM TCDD for 24 h before addition of DRB (157 µM) in the presence of DMSO or 10 nM TCDD. RNA was prepared at the times shown and used for RT-PCR analysis. Data are presented as a percentage of the mean signal at t = 0 and expressed as the mean ± S.D. of three independent determinations. BSA, bovine serum albumin.

Since our rat hepatocyte results are consistent with a transcriptional mechanism for CYP2C11 suppression by TCDD, we focused our mechanistic studies on the 5'-flanking region of the CYP2C11 gene. We identified five DRE-like sequences in the CYP2C11 5'-flank, which contain the four invariant core nucleotides and two or fewer mismatches with the AHR-binding consensus sequence (Yao and Denison, 1992). All of these sequences represent potential AHR-binding sites, but none are predicted to be functional enhancer elements, based on comparisons with the consensus sequence (Lusska et al., 1993) for Cyp1a1 up-regulation. We hypothesized that one or more of these elements may function as "inhibitory DREs" in the down-regulation of CYP2C11. Electrophoretic gel retardation analysis indicated that incubation of in vitro transformed Hepa-1 cytosol with a ³²P-labeled DRE (Cyp1a1 WT-DRE) resulted in formation of a TCDD-inducible band representing the interaction of the transformed cytosolic AHR with the DRE sequence (Fig. 2A). Competitive gel retardation analysis using 10- and 100-fold molar excess unlabeled CYP2C11 DRE-like sequences showed that CYP2C11-DRE3 displayed the greatest ability to bind the AHR complex (Fig. 2A). An identical pattern of competition was obtained when rat liver cytosol was used as the source of AHR (data not shown). To determine the relative affinities of the CYP2C11-DRE sequences for the activated AHR complex, we performed competition studies using increasing amounts (0.1- to 1000-fold excess) of unlabeled CYP2C11-DREs to compete with the labeled Cyp1a1 WT-DRE for binding the activated AHR (Fig. 2B). This confirmed that CYP2C11-DRE3 was an effective competitor with an IC₅₀ value in the nanomolar range and only a 5-fold lower affinity for the AHR complex than the Cyp1a1 WT-DRE. The other CYP2C11-DRE sequences showed at least 50-fold lower affinity than the Cyp1a1 WT-DRE, and were similar in affinity to the MUT-DRE, which contains a mutation in one of the four invariant core nucleotides. Additionally, we showed that radiolabeled CYP2C11-DRE3 can directly interact with the AHR complex (data not shown); this interaction shows DRE sequence specificity and antibodies were used to confirm that AHR and ARNT are components of this complex. These data suggest that a potential binding site for the AHR exists in the 5'-flanking region of the CYP2C11 gene.

View larger version (52K): [in this window] [in a new window]   Fig. 2.   Competitive gel retardation analysis to determine relative abilities of CYP2C11 DRE-like sequences to compete for binding of the AHR to a 32P-labeled Cyp1a1 WT-DRE. A, Hepa-1 cytosol was incubated for 2 h at room temperature with DMSO or 20 nM TCDD. Following incubation, cytosol was mixed with either no competitor oligonucleotide (lanes 1, 2), 10× or 100× molar excess of unlabeled Cyp1a1 WT-DRE (lanes 3, 4), or 10× or 100× molar excess of each of the unlabeled CYP2C11-DREs (lanes 5-14). 32P-labeled Cyp1a1 WT-DRE was then added, and DNA-protein interactions were visualized by gel retardation analysis. The arrow indicates the ligand-inducible interaction of the AHR complex with the labeled Cyp1a1 WT-DRE, and F indicates free Cyp1a1 WT-DRE probe. Similar results were obtained in at least one additional experiment with an independent batch of cytosol. B, relative binding affinities of the CYP2C11 DRE-like sequences for the transformed Hepa-1 AHR. Competitive gel retardation assays were carried out as described above, except that a full range of concentrations for all unlabeled competitor oligonucleotides was investigated. TCDD-inducible binding of the AHR to the 32P-labeled Cyp1a1 WT-DRE was quantitated by phosphorimaging analysis. Specific binding is expressed as a percentage of the binding observed in the absence of a competitor oligonucleotide. Similar results were obtained in at least one additional experiment with an independent batch of cytosol.

To further study the role of the 5'-flanking sequence of CYP2C11 in suppression by AHs, we did DNase I footprinting studies. The in vivo MC treatment regimen causes an approximately 50% decrease in the rate of CYP2C11 transcription within 6 h (Lee and Riddick, 2000). RT-PCR analysis showed that hepatic CYP1A1 mRNA was induced by this treatment, suggesting that the AHR had been activated (Fig. 3A). In the CYP2C11 proximal promoter region (Fig. 3B), we observed footprints at the translation start site (ATG), the transcription start site (+1), the TATA box, the NF-1 like, the HNF-3 like, and the HNF-1 like consensus sites, and at the glucocorticoid response element (Fig. 3B), confirming some of the previous findings of Sundseth et al. (1992). The transcription start site contains an NF-B consensus site that has been implicated in suppression of CYP2C11 by IL-1 (Iber et al., 2000). Further upstream, we observed footprints at the Silencer 400 (Fig. 3C) and 1200 sites (Fig. 3E) [characterized by Strom et al. (1994)], the HPF-1 site (Fig. 3C), the signal transducer and activator of transcription 5 binding site and its adjacent HNF3 site (Fig. 3E) [implicated in growth hormone control, characterized by Park and Waxman (2001)], an E-box element (Fig. 3D), and the CYP2C11-DRE3 that we characterized in the gel retardation assays (Fig. 3D). In all regions examined, there was no difference in protein binding pattern between the nuclear extracts prepared from vehicle- and MC-treated rats. The presence of a footprint at the CYP2C11-DRE3 site with both vehicle- and MC-treated samples is reminiscent of rabbit CYP1A1 DREs, which bind the upstream stimulatory factor-1 in the presence or absence AH treatment (Takahashi and Kamataki, 2001). It will be necessary to study binding of nuclear proteins to the CYP2C11 gene in its nucleosomal configuration.

View larger version (103K): [in this window] [in a new window]   Fig. 3.   DNase I footprinting analysis of the CYP2C11 5'-flanking region with nuclear extracts from corn oil- and MC-treated rats. A, RT-PCR analysis of CYP1A1 mRNA and the internal control -actin, using RNA from livers used in footprinting reactions. B to E, DNase I (0.01-0.25 units) and rat liver nuclear extracts (20-30 µg protein) were used. G + A/C + T indicate ladders generated by Maxam-Gilbert sequencing of the labeled probe,  indicates no extract, V indicates extract from corn oil-treated rat, and MC indicates extract from MC-treated rat. Vertical lines denote important footprinted regions. Arrows show sites of nuclear extract-induced DNase I hypersensitivity. B, radiolabeled lower strand of sequence from +30 to 185; probe A (numbering is relative to transcription start site). C, radiolabeled upper strand of sequence from 405 to 268; probe A. D, radiolabeled upper strand of sequence from 1625 to 1504; probe B. E, radiolabeled upper strand of sequence from 1280 to 1133; probe C. Similar results were obtained in at least one additional experiment with an independent set of nuclear extract preparations. GRE, glucocorticoid response element; STAT5, signal transducer and activator of transcription 5.

Luciferase reporter constructs were used in transient transfection studies to assess functional aspects of CYP2C11 transcriptional regulation. Our initial transfection experiments were performed in liver-derived cell lines of mouse, rat, and human origin. In transfected Hepa-1, BRL 5637, and HepG2 cells (Table 1), no decrease in luciferase activity was found with any vector tested following a 24-h treatment with TCDD. The pGudluc1.1 vector (a positive control for AHR activation) was strongly induced by TCDD in Hepa-1 (25-fold), BRL 5637 (13-fold), and HepG2 (214-fold) cells. In Hepa-1 and HepG2 cells, all constructs, regardless of whether sections of the CYP2C11 5'-flank were present, showed a small (approximately 2-fold) but significant increase in luciferase activity in response to TCDD. A similar but less pronounced trend was observed in BRL 5637 cells. The small inductive response to TCDD with all pGL3-based vectors may be attributed to a nonspecific transcriptional effect or a potentially functional DRE we have identified in the ampicillin resistance gene; however, this requires further investigation with suitably modified neutral vectors. Additionally, TCDD was unable to suppress luciferase activity in HepG2 cells stably transfected with the (2390-2C11)-pGL3 construct (data not shown).

View this table: [in this window] [in a new window]   TABLE 1 Effect of TCDD on luciferase reporter gene activity in transiently transfected Hepa-1, BRL 5637, and HepG2 cells All data are expressed in arbitrary luciferase units (normalized for -galactosidase activity) as mean ± S.D. of triplicate determinations in a single transfection experiment. Similar results were obtained in at least one additional independent transfection experiment.

To conduct transfections in a cellular system that maintains CYP2C11 expression and in which the endogenous CYP2C11 gene is suppressed by AHs, we used primary rat hepatocytes cultured on matrigel. Following electroporation, hepatocytes were treated with TCDD or IL-1 4 h after plating and harvested 20 h later. TCDD did not cause suppression of any CYP2C11-reporter construct but did cause an 11-fold increase in pGudluc1.1 activity (Fig. 4A). At this time-point, IL-1 caused a weak suppression of (196-2C11)-pGL3, but not of the longer CYP2C11 reporter constructs (Fig. 4B). At the time of these reporter studies, the hepatocytes have not recovered expression of endogenous CYP2C11 (Liddle et al., 1992). To study our reporter constructs under conditions that maintain endogenous CYP2C11 expression, we developed a method to transfect hepatocytes after 4 days in culture on matrigel. Treatment with TCDD did not cause suppression of luciferase activity from the reporter constructs (Fig. 4C). In fact, there was significant induction of luciferase activity from the (196-2C11)-pGL3 construct and an insignificant increase from the other CYP2C11-reporter constructs. The control plasmid pGL3-Basic showed a 3-fold induction and the pGudluc1.1 plasmid showed a 15-fold induction. Under the same conditions, IL-1 caused marked suppression of all CYP2C11-reporter constructs; the pGL3-Basic construct was also suppressed by IL-1 to a lesser degree (Fig. 4D).

View larger version (26K): [in this window] [in a new window]   Fig. 4.   Effects of TCDD and IL-1 on CYP2C11-luciferase reporter activity in transiently transfected primary hepatocytes. A and B, hepatocytes were electroporated with luciferase and Renilla constructs. After 4 h, cells were treated with 10 nM TCDD (A) or 7.5 ng/ml IL-1 (B) and incubated for 24 h. Luciferase activity was normalized to Renilla activity. C and D, after 4 days in culture on matrigel, hepatocytes were transfected with luciferase vectors using Transfast. After 2 h, cells were treated with 10 nM TCDD (C) or 7.5 ng/ml IL-1 (D) and incubated for 24 h. Luciferase activity was normalized to protein content. All data are expressed in arbitrary normalized luciferase units as mean ± S.D. of triplicate determinations in a single experiment. *, significantly different (p  0.05) from DMSO or PBS/BSA control; **, significantly different (p  0.01) from DMSO control; ***, significantly different (p  0.001) from PBS/BSA control, based on Student's t test. Similar results were obtained in at least one additional independent transfection experiment. BSA, bovine serum albumin.

In summary, the present study showed that the 5'-flanking region of the CYP2C11 gene contains a potentially important binding site for the AHR complex. However, under conditions in primary hepatocytes in which the endogenous gene is suppressed by TCDD and the CYP2C11-reporter constructs are suppressed by IL-1, TCDD is unable to cause suppression of CYP2C11-reporter constructs containing up to 2390 bp of the 5'-flank. This implies that AHs down-regulate CYP2C11 by a negative transcriptional mechanism that is not simply due to AHR binding to an identified DRE-like sequence and that is distinct from that used by inflammatory cytokines.