![]() |
|
|
Vol. 30, Issue 5, 541-547, May 2002
Department of Biomedical Sciences, University of Rhode Island, Kingston, Rhode Island
| |
Abstract |
|---|
|
|
|---|
Carboxylesterases hydrolyze numerous endogenous and foreign compounds with diverse structures. Humans and rodents express multiple forms of carboxylesterases, which share a high degree of sequence identity (~70%). Alignment analyses locate in carboxylesterases several functional subsites such the catalytic triad as seen in acetylcholinesterase. The aim of this study was to determine among human and rodent carboxylesterases the immunorelatedness, overlapping substrate specificity, differential sensitivity to serine enzyme inhibitors, tissue distribution, and tumor-related expression. Six antibodies against whole carboxylesterases or synthetic peptides were tested for their reactivity toward 11 human or rodent recombinant carboxylesterases. The antibodies against whole proteins generally exhibited a broader cross-reactivity than the anti-peptide antibodies. All carboxylesterases hydrolyzed para-nitrophenylacetate and para-nitrophenylbutyrate. However, the relative activity varied markedly from enzyme to enzyme (>20-fold), and some carboxylesterases showed a clear substrate preference. Carboxylesterases with the same functional subsites had a similar profile on substrate specificity and sensitivity toward phenylmethylsulfonyl fluoride (PMSF) and paraoxon, suggesting that these subsites play determinant roles in the recognition of substrates and inhibitors. Among three human carboxylesterases, HCE-1 hydrolyzed both substrates to a similar extent, whereas HCE-2 and HCE-3 showed an opposite substrate preference. All three enzymes were inhibited by PMSF and paraoxon, but they showed a marked difference in relative sensitivities. Based on immunoblotting analyses, HCE-1 was present in all tissues examined, whereas HCE-2 and HCE-3 were expressed in a tissue-restricted pattern. Colon carcinomas expressed slightly higher levels of HCE-1 and HCE-2 than the adjacent normal tissues, whereas the opposite was true with HCE-3.
| |
Introduction |
|---|
|
|
|---|
Carboxylesterases structurally
belong to a superfamily of
/
-fold proteins, which consist of
alternate
-helix and
-sheets connected by loops with a varying
length (Oakeshott et al., 1999
). These enzymes hydrolyze chemicals
containing such functional groups as a carboxylic acid ester, amide,
and thioester (Parkinson, 1995
; Satoh and Hosokawa, 1998
). In the
presence of an alcohol, carboxylesterases catalyze transesterification
reaction, which accounts for the conversion of cocaine to ethylcocaine
(Boyer and Petersen, 1992
). Carboxylesterase activity is widely
distributed in mammalian tissues, with the highest levels present in
liver microsomes (Satoh and Hosokawa, 1998
). High abundance of
carboxylesterases in the liver is linked to certain cellular structural
functions, particularly in directing protein targeting (Medda et al.,
1987
). For example, egasyn, a liver microsomal carboxylesterase, binds
to
-glucuronidase via its active site, which retains this enzyme
within the endoplasmic reticulum. In rabbits, microsomal
carboxylesterases are shown to interact with and regulate the secretion
of acute-phase response proteins, such as C-reactive protein (Macintyre
et al., 1994
). Given the fact that many therapeutic agents are esters
or amides, carboxylesterase-mediated hydrolysis is given an important
consideration in drug designs (Graffner-Nordberg et al., 1998
; Buchwald
and Bodor, 1999
).
Multiple forms of carboxylesterases are identified in several mammalian
species (Satoh and Hosokawa, 1998
). Studies on cDNA cloning have
identified multiple distinct gene products in rodents and humans, but
the number is far less than that identified by electrophoresis
(Mentlein et al., 1987
; Satoh and Hosokawa, 1998
). The cDNA-deduced
amino acid sequences of these carboxylesterases have several notable
features. They are synthesized as a larger precursor with an N-terminal
signal peptide commonly seen in secretory proteins (Yan et al., 1994
,
1995
; Satoh and Hosokawa, 1998
). Carboxylesterases have four conserved
cysteine residues and one or more putative N-glycosylation
sites. A catalytic triad composing Ser, His, and Glu is located as that
seen in acetylcholinesterase (Sussman et al., 1991
). Some
carboxylesterases have a C-terminal HXEL consensus sequence, through
which the esterases are retained in the endoplasmic reticulum (Yan et
al., 1995
). Finally, mature carboxylesterases contain approximately 540 residues with a high degree of sequence identity (~70%), even
cross-species. The N-terminal half is highly conserved, whereas the
C-terminal half is relatively diverse.
Carboxylesterases are shown to hydrolyze such compounds as choline
esters, phospholipids, retinyl esters, and cholesteryl esters (Mentlein
et al., 1984
; Ghosh et al., 1995
; Sun et al., 1997
; Barr et al., 1998
),
suggesting that these esterases play an important physiological role.
However, studies on carboxylesterases largely focus on detoxication of
pesticides and metabolism of drugs and other xenobiotics (Satoh and
Hosokawa, 1998
). Carboxylesterases are structurally similar to
acetylcholinesterase, a well established target of organophosphorus and
carbamate insecticides during acute exposure (Sussman et al., 1991
).
Binding of carboxylesterases to these insecticides, therefore, is
considered as a detoxication pathway. Tissue-specific expression of
carboxylesterases is shown to determine the location and intensity of
certain drugs. For example, serum carboxylesterase has a markedly
higher rate at hydrolyzing procaine than its amide analog procainamide;
therefore, procaine is used mainly as a local anesthetic, whereas
procainamide is used for systematic indications such as cardiac
arrhythmia (Parkinson, 1995
). Carboxylesterase-based metabolism is used
for activation of ester prodrugs. For example, irinotecan is rapidly converted by carboxylesterases to 7-ethyl-10-hydroxycamptothecin, a
potent inhibitor of topoisomerase I (Saltz, 1997
). Irinotecan is widely
used for a wide range of malignancies. However, some patients respond
to it poorly, presumably due to lower levels or polymorphistic variants
of carboxylesterases (Canal et al., 1996
; Saltz, 1997
).
The aim of this study was to determine among human and rodent carboxylesterases the immunorelatedness, overlapping substrate specificity, differential sensitivity to serine enzyme inhibitors, tissue distribution, and tumor-related expression. Six antibodies against whole carboxylesterases or synthetic peptides were tested for their reactivity toward 11 human or rodent recombinant carboxylesterases. The antibodies against whole proteins generally exhibited a broader cross-reactivity than the anti-peptide antibodies. All carboxylesterases hydrolyzed para-nitrophenylacetate and para-nitrophenylbutyrate. However, the relative activity varied markedly from enzyme to enzyme (>20-fold), and some carboxylesterases showed a clear substrate preference. Among three human carboxylesterases, HCE-11 hydrolyzed both substrates to a similar extent, whereas HCE-2 and HCE-3 showed an opposite substrate preference. All three enzymes were inhibited by PMSF and paraoxon, but they showed a marked difference in relative sensitivities. HCE-1 was present in all tissues examined, whereas HCE-2 and HCE-3 were expressed in a tissue-restricted pattern. Colon carcinomas expressed slightly higher levels of HCE-1 and HCE-2 than the adjacent normal tissues, whereas the opposite was true with HCE-3.
| |
Materials and Methods |
|---|
|
|
|---|
Chemicals and Supplies. Paraoxon, PMSF, para-nitrophenylacetate, and para-nitrophenylbutyrate were from Sigma Chemical (St. Louis, MO). The goat anti-rabbit IgG conjugated with alkaline phosphatase or horseradish peroxidase and chemiluminescent substrate were from Pierce Chemical (Rockford, IL). Human tissue homogenates (protein medley) were from BD Biosciences Clontech (Palo, Alto, CA). Cell culture media, liver cDNA libraries, LipofectAMINE, and Plus Reagent were purchased from Invitrogen (Carlsbad, CA). Anti-actin antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Unless otherwise indicated, all other reagents were purchased from Fisher Scientific (Pittsburgh, PA).
Molecular Cloning of Human, Rat, and Mouse Carboxylesterases.
Screening of cDNA libraries (human liver and placenta, rat liver, mouse
liver) was conducted with a Gene-Trapp cDNA positive selection system
(Invitrogen) as described previously (Hu and Yan, 1999
). Briefly,
double-stranded phagemid DNA was isolated from the cDNA library and
converted to ssDNA by a sequential digestion with Gene II and Exo III.
The ssDNA was denatured at 95°C for 1 min and chilled in ice for 1 min. Two oligonucleotides (TGTGACCATCTTTGGAGAGTC and
TTTGGCGAGTCTGCGGGTGGC) were synthesized based on the sequence encoding
a motif (GXSXG) common to all cloned mammalian carboxylesterases (Satoh
and Hosokawa, 1998
). The oligonucleotides (3 µg) were then biotinylated in a total volume of 25 µl with biotin-14-dCTP and terminal deoxynucleotidyl transferase. Hybridization between the ssDNAs
(2.5 µg) from the library and the biotinylated oligonucleotides (20 ng) were conducted at 37°C for 1 h with the hybridization buffer
provided with the kit. The hybridized ssDNAs were then captured by
streptavidin-coated beads and repaired by a thermostable polymerase.
The repaired ssDNAs were then transformed into HB101 bacteria. For
sequencing, the phagemid DNA was isolated with a Spin Mini-prep kit
(QIAGEN, Chatsworth, CA) and sequenced with vector/internal synthetic
primers on both strands (Yan et al., 1995
).
Transfection. Human embryonic kidney cells (293T) were plated at a density of 60% in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. After reaching 85% confluence, cells were transfected by LipofectAMINE and Plus Reagent. A plasmid construct or the empty vector (4 µg/100-mm dish) was initially mixed with 20 µl of Plus Reagent diluted in 750 µl of serum-free medium for 15 min, and then mixed with 30 µl of LipofectAMINE diluted in 5 ml of serum-free medium for 15 min. The final transfection complexes were added to a monolayer of 293T cells. After a 3 h-incubation, the media were replaced by normal culture media and incubated for 48 h in a 37°C humidified incubator with 5.0% CO2. Cells were rinsed and harvested in 1.5 ml of phosphate-buffered saline. The cell suspension was sonicated by a Branson sonifier, and cell debris was removed by centrifugation at 12,000g for 10 min at 4°C. The supernatant was assayed for hydrolytic activity toward para-nitrophenylacetate and para-nitrophenylbutyrate.
Enzymatic Assays and Inhibition Studies.
The enzymatic activity was determined spectrophotometrically as
described previously (Morgan et al., 1994
). Unless otherwise indicated,
the 1-ml sample cuvette contained 20 µg of lysates from transfected
cells in 100 mM potassium phosphate buffer, pH 7.4, and 1 mM substrate
at room temperature. Reactions were initiated by the addition of
substrate (10 µl of 100 mM stock in acetonitrile), and hydrolytic
rate was recorded from an increase in absorbance at 400 nm. The same
experiments were conducted without cell lysates to correct for
nonenzymatic hydrolysis. The extinction coefficient (E400) was determined to be 13 mM
1 cm
1
(para-nitrophenylacetate) or 17 mM
1
cm
1 (para-nitrophenylbutyrate). All
assays were repeated at least three times. For inhibition studies,
lysates (20 µg of protein in 1 ml of 100 mM potassium phosphate
buffer) were incubated at room temperature with various concentrations
of PMSF or paraoxon. After a 5-min incubation, the rate of
para-nitrophenylacetate hydrolysis was
spectrophotometrically measured as described above.
Homogenate Preparation from Human Colon Adenocarcinoma and
Adjacent Normal Tissues.
Tissues were obtained from the Cooperative Human Tissue Network. Colon
adenocarcinomas and the adjacent normal tissues (~0.5 g) were
collected from patients who underwent subtotal colon resection. The
size of tumors was ~5 cm in diameter, and the degree of
differentiation of tumors was moderate or poor as determined by
pathological examination. Tissues (~0.5 g) were homogenized in buffer
containing 20 mM Tris-HCl, 150 mM NaCl, 1% Nonidet P-40, and a set of
protease inhibitors (0.1 mM PMSF, 10 µg/ml pepstatin, 10 µg/ml
leupeptin). The tissue homogenates were subjected to centrifugation at
35,000g for 60 min at 4°C. The supernatants were analyzed
for the abundance of carboxylesterases by Western blots as described
previously (Yan et al., 1995
). Goat anti-rabbit IgG conjugated with
alkaline phosphatase or horseradish peroxidase was used. The
phosphatase activity was detected with colorimetric substrates nitro
blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate, whereas the
peroxidase activity was detected with chemiluminescent substrate. Use
of human tissues was approved by the University Institutional Review Committee.
Other Assays.
Immunization and antibody purification were described elsewhere
(Zhu et al., 2000
). Protein concentration was determined with a BCA kit
(Pierce Chemical) as described by the manufacturer. Data are presented
as mean ± S.D. of at least three separate experiments except
where results of blots are shown, in which case a representative experiments is depicted in the figures.
| |
Results |
|---|
|
|
|---|
Immuno-cross Reactivity.
Mammalian species express multiple forms of carboxylesterases (Satoh
and Hosokawa, 1998
). These enzymes have a similar molecular mass
(~60 kDa) and share a remarkably high degree of sequence identity,
particularly in the N-terminal half. As a result, some of the enzymes
are indistinguishable on conventional Western blots. In the past
several years, we have prepared antibodies against several major types
of human or rodent carboxylesterases, either against whole
carboxylesterases or peptides derived from some of these enzymes (Table
1). These antibodies were tested for their cross-reactivity toward 11 human or rodent recombinant
carboxylesterases. The enzymes included human HCE-1, HCE-2, HCE-3, and
HCE-1 variant, rat hydrolase A (HA), B (HB), S (HS), and E, and mouse
M-LK, M-E, and M-S. cDNAs encoding these enzymes were isolated by
screening individual rat or mouse liver library as well as combined
human liver and placental libraries (Hu and Yan, 1999
; Yan et al.,
1999
). The isolated cDNAs were subjected to sequencing analyses, and identification of each cDNA was made based on the basic local alignment
search tool search (
98%). For clarity, the names used in this report
and the corresponding names originally reported for each enzyme are
summarized in Table 2. It should be
emphasized that HCE-1 variant was originally identified to have two
single amino acid deletions: alanine and glutamine at positions of
1 and 435, respectively (Kroetz et al., 1993
). However, the cDNA encoding
the variant in this study was found to have the alanine deletion only.
|
|
|
Hydrolysis of para-Nitrophenylacetate and
para-Nitrophenylbutyrate.
Next, we examined the hydrolytic activity of these carboxylesterases
toward para-nitrophenylacetate and
para-nitrophenylbutyrate. These two esters were chosen for
the following reasons. We previously demonstrated that human placental
microsomes differentially hydrolyzed both substrates (Yan et al.,
1999
). More importantly, their structural relationship resembles that
between acetyl- and butyrylcholine, two chemicals that are
differentially hydrolyzed by acetyl- and butyrylcholinesterase
(Chatonnet and Lockridge, 1989
). As shown in Fig.
2, transfection with the empty vector
caused little hydrolytic activity toward both substrates. In contrast,
transfection with plasmid constructs encoding carboxylesterases
generally caused a marked increase in hydrolytic activity with two
notable exceptions: rat hydrolase S and mouse M-S. The maximum activity
(~12 µmol/mg/min) toward para-nitrophenylacetate was
observed in the lysates from cells transfected with HCE-2 and M-LK. In
contrast, the maximum activity (18 µmol/mg/min) toward
para-nitrophenylbutyrate was observed in the lysates from
cells transfected with HCE-3 and hydrolase A. Samples exhibiting
similar immunostaining intensity had a marked difference in hydrolyzing
the substrates assayed. Lysates from HCE-1 and HCE-3, for example,
yielded a comparable immunostaining intensity by the anti-HCE-1
antibody; however, HCE-3 lysates exhibited a markedly higher activity
than HCE-1 lysates (3- to 4-fold depending on the substrate used). In
addition, some carboxylesterases hydrolyzed both substrates to a
comparable extent, whereas others exhibited a clear substrate
preference. For example, HCE-1 exhibited no apparent preference toward
either substrate. In contrast, hydrolase A preferably hydrolyzed
para-nitrophenylbutyrate at a ratio of 4 over
para-nitrophenylacetate, whereas the opposite was true with
carboxylesterases such as HCE-2 (a ratio of 6). These findings suggest
that intrinsic catalytic properties of carboxylesterases are largely
responsible for the observed difference on the overall hydrolytic
activity among these enzymes although the difference in the expression
levels is a likely contributing factor as well.
|
Differential Inhibition by PMSF and Paraoxon.
Site-directed mutagenesis studies on cholinesterases demonstrate that
mutants with an increase in hydrolyzing certain substrates also
increase the reactivity toward a structurally related inhibitor (Vellom
et al., 1993
). Next, we examined whether the hydrolytic activity of
carboxylesterase was correlated with their sensitivity to paraoxon or
PMSF, two well-known serine enzyme inhibitors (Ordentlich et
al., 1996
; Das et al., 2000
). As shown in Fig.
3, both compounds effectively inhibited
hydrolytic activity toward para-nitrophenylacetate in a
concentration-dependent manner. Rat hydrolase S and mouse M-S were
excluded from the inhibition studies because both had little activity
toward this substrate (Fig. 2). Overall, PMSF is less potent than
paraoxon and PMSF-mediated inhibition exhibited a greater variation
than paraoxon-mediated inhibition from enzyme to enzyme (Fig. 3A). For
example, PMSF at a concentration of 2 µM caused an inhibition of
hydrolase A by as much as 95%, whereas the same concentration caused
little change on M-LK-mediated hydrolysis. Some carboxylesterases
exhibited a good correlation between hydrolytic activity and
sensitivity to both inhibitors. The hydrolytic activity of rat
hydrolase E toward para-nitrophenylacetate and
para-nitrophenylbutyrate (Fig. 2), for example, was higher
than that of mouse M-E, and so was the sensitivity of hydrolase E to
PMSF and paraoxon inhibition (Fig. 3). Among human carboxylesterases,
HCE-3 was the most sensitive to PMSF, whereas HCE-1 and HCE-2 were
moderately inhibited. In contrast, HCE-2 exhibited a marked resistance
to paraoxon inhibition, whereas HCE-1 and HCE-3 were comparably
inhibited (Fig. 3).
|
Tissue Distribution of HCE-1, HCE-2, and HCE-3.
Hydrolytic activity is present ubiquitously in mammalian tissues;
however, to what extent carboxylesterases contribute to this activity
remains unclear (Satoh and Hosokawa, 1998
). We have demonstrated that
antipeptide antibodies are highly specific among human
carboxylesterases (Fig. 1). Therefore, we used these antibodies to
determine tissue distribution of HCE-1, HCE-2, and HCE-3. Overall, the
anti-HCE-1 antibody detected cross-reactive proteins among all tissues
tested (Fig. 4). The immunostaining
intensity was comparable with exceptions of the liver, placenta,
spleen, and brain. The liver had the highest immunostaining intensity,
whereas the placenta, spleen, and brain showed the weakest intensity. In contrast, cross-reactive proteins with HCE-2 or HCE-3 were more
tissue-restricted. High levels of HCE-2 cross-reactive proteins were
detected in the liver, kidney, and ileum, whereas high levels of HCE-3
cross-reactive proteins were detected in the adrenal and brain. Some
organs such as the kidney, adrenal, and ileum expressed cross-reactive
proteins detected by all three antibodies. The antibody against HCE-1
cross-reacts with HCE-3, whereas the antibody against HCE-2 or HCE-3 is
highly specific to respective enzyme (Fig. 1), suggesting that these
organs express at least HCE-2 and HCE-3 (anti-HCE-1 cross-reacts with
HCE-3). Interestingly the liver expressed no HCE-3 although this organ
contains the highest levels of many xenobiotic-metabolizing enzymes.
|
Tumor-Related Expression of HCE-1, HCE-2, and HCE-3.
Carboxylesterases activate ester or amide prodrugs, and HCE-2 not HCE-1
has been shown to effectively activate irinotecan, a widely used
chemotherapeutic agent for a variety of malignancies, including colon
carcinoma (Ewesuedo and Ratain, 1997
; Saltz, 1997
; Stucky-Marshall,
1999
). Next, we examined whether human carboxylesterases are
differentially expressed in colon cancer and its adjacent normal
tissue. Paired samples from patients who underwent subtotal colon
resection were collected, and tissue homogenates were analyzed for the
abundance of HCE-1, HCE-2, and HCE3. As shown in Fig. 5, all three proteins were present in
colon carcinomas and the adjacent normal homogenates. However, the
relative abundance varied between the tumor and normal tissues. Without
exceptions, levels of both HCE-1 and HCE-2 were slightly higher in the
adjacent normal tissues than those in the carcinomas. In contrast,
levels of HCE-3 were slightly higher in the carcinomas than those in
the adjacent normal tissues (Fig. 5). HCE-3 was previously reported to
be abundantly present in brain blood vessels (Yamada et al., 1994
; Mori
et al., 1999
), and tumor-related increase on the expression of this
carboxylesterase suggests that this enzyme plays a role in
angiogenesis, although its precise action remains to be determined.
|
| |
Discussion |
|---|
|
|
|---|
Mammalian carboxylesterases structurally belong to a superfamily
of
/
-fold proteins, which consist of alternate
-helix and
-sheets connected by loops with a varying length. These enzymes hydrolyze endogenous and foreign chemicals containing such functional groups as a carboxylic acid ester, amide, and thioester. Studies on
molecular cloning demonstrate that these enzymes share a high degree of
sequence identity. In this report, we have tested 11 human and rodent
carboxylesterases on their immunorelatedness, substrate specificity,
sensitivity to inhibitors, tissue distribution, and tumor-related
expression. Antibodies against whole carboxylesterases generally
exhibit a broader cross-reactivity than anti-peptide antibodies. All
recombinant carboxylesterases hydrolyze both
para-nitrophenylacetate and
para-nitrophenylbutyrate with some carboxylesterases having a substrate preference. The hydrolytic activity is inhibited by PMSF
and paraoxon, but the sensitivity to each inhibitor differs markedly
from enzyme to enzyme. Human HCE-1 is widely distributed among 14 normal tissues, whereas HCE-2 and HCE-3 are more tissue-restricted. In
addition, human carboxylesterases are differentially expressed between
colon carcinoma and the adjacent normal tissues. HCE-1 and HCE-2 are
slightly more abundant in the adjacent normal tissues, whereas the
opposite is true with HCE-3.
The substrate preference shown by some carboxylesterases between
para-nitrophenylacetate and
para-nitrophenylbutyrate resembles that by
acetylcholinesterase and butyrylcholinesterase on acetylcholine and
butyrylcholine (Chatonnet and Lockridge, 1989
; Vellom et al., 1993
).
Acetylcholinesterase rapidly hydrolyzes acetylcholine but exhibits a
much diminished activity toward butyrylcholine. In contrast,
butyrylcholinesterase shows far less selectivity on the acyl group and
effectively hydrolyzes both choline esters. X-ray structural analyses
and site-directed mutagenesis studies reveal that phenylalanines 288 and 290 in the acyl pocket (numbered according to Torpedo
californica acetylcholinesterase; Sussman et al., 1991
) are
responsible for such a differential hydrolysis of the choline esters
(Harel et al., 1992
; Ordentlich et al., 1993
; Vellom et al., 1993
).
Replacement of one (Phe-288) or both phenylalanines with
butyrylcholinesterase leucine and valine markedly increases hydrolytic
activity toward butyrylcholine. Carboxylesterases and cholinesterases
have several features in common:
/
-folding in overall structure,
the Ser-His-Glu triad in catalysis, and a moderate identity in primary
sequence (~30%). However, sequence alignment analyses of
carboxylesterases locate at residues 288 and 290 neither the
phenylalanines as seen in acetylcholinesterase nor leucine and valine
as seen in butyrylcholinesterase. Instead, carboxylesterases contain a
well conserved serine at residue 288 and a less conserved proline at
residue 290. The highly conserved serine suggests that preferable
hydrolysis by carboxylesterases between
para-nitrophenylacetate and
para-nitrophenylbutyrate is specified by the overall
sequence of the acyl pocket but not by residues 288 and 290 alone. In
support of this possibility, HCE-3 and hydrolase A have an identical
sequence in this stretch (16 amino acids) and both preferably hydrolyze
para-nitrophenylbutyrate (Robbi et al., 1990
; Mori et al.,
1999
). In contrast, HCE-2 and hydrolase E preferably hydrolyze
para-nitrophenylacetate. HCE-2 has a 12-residue deletion in
the acyl pocket, and hydrolase E mismatches HCE-3 and hydrolase A by
40% in this region (Robbi et al., 1990
; Pindel et al., 1997).
Rat hydrolase S and mouse M-S show little activity toward either
substrate, although abundant expression in the respective transfected
cells is detected by Western blots (Fig. 1). Both hydrolase S and M-S,
like HCE-2, have a deletion in the acyl pocket (Pindel et al., 1997).
However, such a deletion may not be completely responsible for the lack
of hydrolytic activity. Instead, the expressed hydrolase S and M-S in
the lysates may lack the conformation necessary to confer catalysis.
Several lines of evidence support this possibility. First, we have
previously demonstrated with immunoprecipitation experiments that serum
hydrolase S rapidly hydrolyzes para-nitrophenylacetate (Yan
et al., 1995
), providing direct evidence that mature hydrolase S is
capable of hydrolyzing this substrate. Second, serum hydrolase S has a
much higher molecular weigh (~72 kDa) than its calculated molecular
mass (~58 kDa) due to extensive glycosylation, and such a
post-translational modification has been found to play a major role in
folding carboxylesterases into a catalytically active enzyme (B. Yan
and D. Yang, 1995
; unpublished data). In this study, the major
product (>90%) of both hydrolase S and M-S in the lysates has a
molecular mass of ~60 kDa, suggesting that they are incompletely
glycosylated. It should be emphasized that hydrolase S and M-S
represent carboxylesterases that are most extensively
N-linked glycosylated (five putative sites); therefore, they
are easily subjected to being incompletely glycosylated, particularly
in an overexpression system such as transfected cells. In addition,
mature hydrolase S and E-S are secreted into the serum due to the lack
of the C-terminal retention tetrapeptide (HXEL) (Yan. et al., 1995
),
and the inability of their microsomal precursors to hydrolyze either
substrate suggests that they contribute insignificantly to the overall
intracellular hydrolysis.
In addition to the acyl pocket, studies on cholinesterase have revealed
that several other functional subsites play roles in substrate
recognition and inhibitor reactivity. Sequence alignment analyses
reveal that carboxylesterases have similar functional subsites,
including the catalytic triad, hydrophobic subsite, acyl pocket,
peripheral anionic subsite, H-bond network, and oxyanion hole
(Ordentlich et al., 1996
, 1998
). In this report, we demonstrate that HCE-3 and hydrolase A, identical on all subsites with only one
substitution in the H-bond network (Glu
Asp-443), have the same
substrate preference and are comparably inhibited by both paraoxon and
PMSF (Figs. 2 and 3), providing direct evidence on the importance of
these subsites in catalysis and inhibition of carboxylesterases.
Substrate recognition and inhibitor reactivity likely use similar
functional subsites but hydrolytic activity is not always correlated
with the sensitivity to all inhibitors. For example, M-LK rapidly
hydrolyzes both para-nitrophenylacetate and
para-nitrophenylbutyrate. However, this enzyme is highly
sensitive to paraoxon but only moderately inhibited by PMSF (Fig. 3),
suggesting that the same functional architecture reacts differently
with inhibitors or substrates. Studies on insecticide resistance reveal in acetylcholinesterase, nine residues that are responsible for altered
sensitivity to commonly used insecticides (Newcomb et al., 1997
; Walsh
et al., 2001
). Surprisingly, only two of these residues are conserved
between carboxylesterases and acetylcholinesterase, suggesting that
these two types of enzymes, although highly similar on their overall
structure, react differentially with a vast array of insecticides.
Given the fact that mammalian species express multiple forms of
carboxylesterases, which are regulated in species- and
chemical-dependent manners (Satoh and Hosokawa, 1998
; Zhu et al.,
2000
), carboxylesterases are likely contributing significantly to species and individual variation on organophosphate toxicity.
Immuno-cross-reactivity, on the other hand, appears to be determined by
the overall sequence identity. For example, hydrolase B has the highest
sequence identity with hydrolase A (70.1%), hydrolase E (71.8%), M-E
(72.6%), and M-LK (82.0%); therefore, the anti-HB antibody
cross-reacts strongly with these enzymes except hydrolase A. The
anti-HB antibody was immunoabsorbed against purified hydrolase A;
therefore, antibody against epitopes shared by hydrolase A and B was
removed (Morgan et al., 1994
). Hydrolase S has a comparable sequence
identity (66.4-82.0%) with all carboxylesterases except HCE-2
(46.1%); therefore, the anti-HS antibody cross-reacts to a similar
extent with all carboxyl-esterases but HCE-2 (Fig. 1). It is
interesting to note that hydrolase S and HCE-2 share a much higher
sequence identity (65.6%) in the N-terminal half than the overall
sequence identity (46.1%); however, the anti-HS antibody shows no
cross-reactivity toward HCE-2 (Fig. 1), suggesting that the C-terminal
half of carboxylesterases contains epitopes with stronger
immunogenicity. Based on the immuno-cross-reactivity detected by the
anti-peptide antibodies, it appears that the C-terminal tetrapeptide is
sufficient to invoke production of antibody. For example, the
anti-HCE-2 antibody was raised against a peptide ending with HTEL, this
antibody cross-reacts moderately with carboxylesterases having this
C-terminal tetrapeptide (hydrolase E and M-E). In addition, the
anti-HCE-1 antibody was raised against a peptide ending with HIEL, this
antibody cross-reacts even with carboxylesterases having HVEL (e.g.,
HCE-3) but not HTEL (e.g., HEC-2). Apparently, substitution of the
isoleucine with a polar residue threonine but not a nonpolar residue
valine significantly affects immunoreactivity with the HCE-1 antibody.
Tissue-dependent and tumor-related expression of human
carboxylesterases has both physiological and pharmacological
significance. HCE-2, for example, is abundantly present in the liver,
intestine, and kidney, internal organs that constantly encounter
foreign chemicals (Fig. 4). Therefore, HCE-2 likely plays important
roles in xenobiotic metabolism. In contrast, HCE-3 is abundantly
expressed in the adrenal and brain, suggesting that this enzyme is
largely involved in the metabolism of endogenous compounds (Fig. 4). In support of this notion, HCE-3 preferably hydrolyzes
para-nitrophenylbutyrate, whereas HCE-2 preferably
hydrolyzes para-nitrophenylacetate (Fig. 2). Endogenous
compounds such as phospholipids and cholesteryl esters are generally
more lipophilic (Sun et al., 1997
; Barr et al., 1998
). Local activation
of prodrugs by carboxylesterases likely has profound clinical
consequence. Irinotecan is effectively used for the treatment of a
variety of cancers, including refractory colon adenocarcinomas in
adults (Ewesuedo and Ratain, 1997
; Saltz, 1997
; Stucky-Marshall, 1999
).
However, side effects include granulocytopenia, gastrointestinal
toxicity, and renal failure (Merrouche et al., 1997
; Persons et al.,
1998
). Irinotecan is rapidly converted by HCE-2 to its cytotoxic
metabolite, 7-ethyl-10-hydroxy-camptothecin. In this report, we
demonstrate that HCE-2 is abundantly expressed in the intestine and
kidney. Activation of irinotecan by HCE-2 in these tissues is likely
responsible for its therapeutic action as well as toxicity.
| |
Footnotes |
|---|
Received December 10, 2001; accepted February 1, 2002.
This work was partially supported by National Institute of Environmental Health Sciences Grant ES07965 and a New Investigator Award from the American Association of Colleges of Pharmacy.
Address correspondence to: Dr. Bingfang Yan, Department of Biomedical Sciences, University of Rhode Island, Kingston, RI 02881. E-mail: byan{at}uri.edu
| |
Abbreviations |
|---|
Abbreviations used are: HCE, human carboxylesterase; PMSF, phenylmethylsulfonyl fluoride; ssDNA, single-stranded DNA; HA hydrolase A, HB, hydrolase B; HS, hydrolase S.
| |
References |
|---|
|
|
|---|
-glucuronidase and is identical to rat esterase-3.
J Biol Chem
262:
7248-7253This article has been cited by other articles:
![]() |
A. Watanabe, T. Fukami, M. Nakajima, M. Takamiya, Y. Aoki, and T. Yokoi Human Arylacetamide Deacetylase Is a Principal Enzyme in Flutamide Hydrolysis Drug Metab. Dispos., July 1, 2009; 37(7): 1513 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-R. Kim, K. Sai, T. Tanaka-Kagawa, H. Jinno, S. Ozawa, N. Kaniwa, Y. Saito, A. Akasawa, K. Matsumoto, H. Saito, et al. Haplotypes and a Novel Defective Allele of CES2 Found in a Japanese Population Drug Metab. Dispos., October 1, 2007; 35(10): 1865 - 1872. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, D. Shi, D. Yang, X. Song, and B. Yan Interleukin-6 Alters the Cellular Responsiveness to Clopidogrel, Irinotecan, and Oseltamivir by Suppressing the Expression of Carboxylesterases HCE1 and HCE2 Mol. Pharmacol., September 1, 2007; 72(3): 686 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tang, M. Mukundan, J. Yang, N. Charpentier, E. L. LeCluyse, C. Black, D. Yang, D. Shi, and B. Yan Antiplatelet Agents Aspirin and Clopidogrel Are Hydrolyzed by Distinct Carboxylesterases, and Clopidogrel Is Transesterificated in the Presence of Ethyl Alcohol J. Pharmacol. Exp. Ther., December 1, 2006; 319(3): 1467 - 1476. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Shi, J. Yang, D. Yang, E. L. LeCluyse, C. Black, L. You, F. Akhlaghi, and B. Yan Anti-Influenza Prodrug Oseltamivir Is Activated by Carboxylesterase Human Carboxylesterase 1, and the Activation Is Inhibited by Antiplatelet Agent Clopidogrel J. Pharmacol. Exp. Ther., December 1, 2006; 319(3): 1477 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Imai, M. Taketani, M. Shii, M. Hosokawa, and K. Chiba Substrate Specificity of Carboxylesterase Isozymes and Their Contribution to Hydrolase Activity in Human Liver and Small Intestine Drug Metab. Dispos., October 1, 2006; 34(10): 1734 - 1741. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Landowski, P. L. Lorenzi, X. Song, and G. L. Amidon Nucleoside Ester Prodrug Substrate Specificity of Liver Carboxylesterase J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 572 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kubo, S.-R. Kim, K. Sai, Y. Saito, T. Nakajima, K. Matsumoto, H. Saito, K. Shirao, N. Yamamoto, H. Minami, et al. FUNCTIONAL CHARACTERIZATION OF THREE NATURALLY OCCURRING SINGLE NUCLEOTIDE POLYMORPHISMS IN THE CES2 GENE ENCODING CARBOXYLESTERASE 2 (HCE-2) Drug Metab. Dispos., October 1, 2005; 33(10): 1482 - 1487. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Imai, M. Imoto, H. Sakamoto, and M. Hashimoto IDENTIFICATION OF ESTERASES EXPRESSED IN CACO-2 CELLS AND EFFECTS OF THEIR HYDROLYZING ACTIVITY IN PREDICTING HUMAN INTESTINAL ABSORPTION Drug Metab. Dispos., August 1, 2005; 33(8): 1185 - 1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Furihata, M. Hosokawa, N. Koyano, T. Nakamura, T. Satoh, and K. Chiba IDENTIFICATION OF DI-(2-ETHYLHEXYL) PHTHALATE-INDUCED CARBOXYLESTERASE 1 IN C57BL/6 MOUSE LIVER MICROSOMES: PURIFICATION, CDNA CLONING, AND BACULOVIRUS-MEDIATED EXPRESSION Drug Metab. Dispos., October 1, 2004; 32(10): 1170 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Song, M. Xie, H. Zhang, Y. Li, K. Sachdeva, and B. Yan THE PREGNANE X RECEPTOR BINDS TO RESPONSE ELEMENTS IN A GENOMIC CONTEXT-DEPENDENT MANNER, AND PXR ACTIVATOR RIFAMPICIN SELECTIVELY ALTERS THE BINDING AMONG TARGET GENES Drug Metab. Dispos., January 1, 2004; 32(1): 35 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Sanghani, S. K. Quinney, T. B. Fredenburg, Z. Sun, W. I. Davis, D. J. Murry, O. W. Cummings, D. E. Seitz, and W. F. Bosron Carboxylesterases Expressed in Human Colon Tumor Tissue and Their Role in CPT-11 Hydrolysis Clin. Cancer Res., October 15, 2003; 9(13): 4983 - 4991. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xie, D. Yang, M. Wu, B. Xue, and B. Yan Mouse Liver and Kidney Carboxylesterase (M-LK) Rapidly Hydrolyzes Antitumor Prodrug Irinotecan and the N-Terminal Three Quarter Sequence Determines Substrate Selectivity Drug Metab. Dispos., January 1, 2003; 31(1): 21 - 27. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||