![]() |
|
|
Vol. 30, Issue 9, 1029-1034, September 2002
Molecular Toxicology Group, School of Biomedical and Life Sciences, University of Surrey, Guildford, United Kingdom
| |
Abstract |
|---|
|
|
|---|
CYP3A4 is the most abundant cytochrome P450 (P450) in human
liver, comprising approximately 30% of the total liver P450 content. This enzyme has an important role in steroid catabolism and metabolism of foreign compounds, with the majority of pharmaceutical compounds being substrates for CYP3A4. The molecular mechanisms that underlie transcriptional activation of CYP3A4 are complex with many steroid hormone nuclear receptors, including glucocorticoid receptor, pregnane
X receptor (PXR), vitamin D receptor, and constitutive androstane
receptor, playing roles. Nowhere is this more evident than in the
induction of CYP3A4 gene expression by glucocorticoids. CYP3A genes
lack a consensus glucocorticoid receptor response element and yet are
highly induced by classical glucocorticoids such as hydrocortisone and
dexamethasone. Recent evidence has demonstrated that glucocorticoids
are ligands for the orphan nuclear receptor PXR, and induction of CYP3A
genes by glucocorticoids may occur primarily through PXR interactions.
In this paper, we present a mutant that disrupts a
hepatocyte-nuclear-factor-3/CCAAT-enhancer binding protein
binding
site in the CYP3A4 proximal promoter. This mutation disrupts induction
of a reporter gene construct by the glucocorticoids dexamethasone and
hydrocortisone; yet induction by the potent PXR ligand rifampicin is
unaffected. Such data provides strong evidence that glucocorticoids
induce CYP3A4 gene expression both through the established
PXR-dependent pathway but also through a PXR-independent pathway.
| |
Introduction |
|---|
|
|
|---|
The
cytochrome P450 superfamily is a group of mixed function oxidases,
present in both eukaryotes and prokaryotes (Nelson et al., 1996
). The
enzymes are based on a haem protein skeleton, with each enzyme having a
unique substrate-binding site. The super family therefore exhibits a
wide substrate profile, and indeed cytochrome
P4501 enzymes are responsible for the majority of
initial metabolism of chemicals, both endogenous and xenobiotic.
In man, the major site of metabolism is the liver. As expected there
are a number of cytochrome P450 molecules present in liver, each with a
spectrum of specific substrates. The cytochrome P450 3A (CYP3A) family
is the most abundant P450 present in human liver, comprising
approximately 30% of the total P450 content (Watkins, 1994
). In
addition, approximately 60% of pharmaceutical drugs currently in use,
which are oxidized during metabolism, are substrates for CYP3A enzymes
(Cholerton et al., 1992
), meaning that this family is of great clinical
importance in xenobiotic metabolism in humans. Of the three CYP3A
enzymes present in man, CYP3A4 is quantitatively the most abundant,
being found in all but one adult liver sample so far screened (Aoyama
et al., 1989
). Hence, CYP3A4 probably contributes the major
CYP3A-mediated metabolism in the population as a whole.
The molecular mechanisms underlying regulation of CYP3A4 gene
expression have been studied by several groups, including ourselves. Initially, 1105 bp of proximal promoter was isolated (Hashimoto et al.,
1993
), and computer analysis showed the presence of several putative
transcription factor binding sites including the estrogen receptor,
chicken ovalbumin upstream promoter-transcription factor, HNF-4,
HNF-5, p53, and octamer transcription factor-1 (Hashimoto et al.,
1993
). Importantly no consensus glucocorticoid receptor binding site
was identified, despite the fact that CYP3A4 is transcriptionally activated by glucocorticoids (Ogg et al., 1999
). This raised the possibility of activation via a nonconsensus glucocorticoid responsive unit, as seen in the rat CYP3A4 ortholog CYP3A23 (Huss et al., 1996
).
There are three possible mechanisms by which glucocorticoids cause
induction of CYP3A4 gene expression. The simplest case, and the one for
which there is the least evidence, is that this induction occurs via
direct interaction of GR with the CYP3A4 promoter. As mentioned above,
no consensus GRE is present in either CYP3A4 or CYP3A23 promoters,
suggesting that if such an interaction does occur, it would be via a
nonconsensus GRE. Such a scenario cannot be excluded as there is a body
of evidence demonstrating DNA-protein interactions of GR with other
response elements, including activator protein-1, nuclear factor-
B,
and simian virus 40 promoter factor 1 (Bamberger et al., 1996
).
However, such a mechanism could not be the sole route of induction as
murine GR knock-outs suggest the role of this receptor is nonessential
for induction (Schuetz et al., 2000
), although such knock-outs could
have resulted in up-regulation of other "rescue" pathways not
usually seen in vivo.
The synthetic glucocorticoid dexamethasone has been shown to act as a
ligand for PXR, the major steroid hormone nuclear receptor controlling
expression of CYP3A gene expression, albeit a poor one (Lehmann et al.,
1998
). As a consensus direct repeat for PXR binding (DR3) is
present within the CYP3A23 glucocorticoid responsive unit (Huss et al.,
1996
), it can be hypothesized that glucocorticoid induction of CYP3A
occurs through activation of PXR. Finally, glucocorticoids may interact
with GR, which in turn stimulates other transcription factors that
interact with the CYP3A promoter. Pascussi and colleagues have
demonstrated that dexamethasone produces an increase in the level of
the nuclear receptors PXR, CAR, and retinoid X receptor
, possibly
through GR-stimulated induction of gene expression (Pascussi et al.,
2000a
,b
). Undoubtedly the in vivo situation is extremely complex, with
some, if not all, the above mechanisms occurring.
In the current study, we have characterized a mutation within the
promoter region of the human CYP3A4 gene which interrupts a putative
complex binding site for both the CCAAT-enhancer binding protein
(C/EBP
) and HNF-3 (Schule et al., 1988
). The mutation results in a reduced affinity for protein binding at these sites, as
demonstrated by electromobility shift assays. Transactivation assays
have been used to show that the observed mutation disrupts the ability
of the CYP3A4 promoter to respond to glucocorticoids but does not
affect the response to the potent PXR-ligand rifampicin. Such data are
the first direct demonstration that glucocorticoids may induce CYP3A4
gene expression through PXR-independent pathways.
| |
Materials and Methods |
|---|
|
|
|---|
Chemicals. Dexamethasone, hydrocortisone, and rifampicin were all of cell culture grade and purchased from Sigma-Aldrich (St. Louis, MO). Unless otherwise stated, all other chemicals were of molecular biology grade and obtained from Sigma-Aldrich.
Plasmid.
The secretory alkaline phosphatase reporter gene pSEAP pro2 was
purchased from CLONTECH (Palo Alto, CA). 301 bp of the CYP3A4 5'
flanking region (
301 bp
+7 bp) were engineered in this reporter gene (hereafter termed pWT) by PCR cloning. Directional cloning was
carried out using primers with restriction enzyme sites for Acc65I (
301A) and BglII (+7B) added to the 5'
terminus (underlined), attached as described below,
301A, GGGGTACCCCAGACAAGGGCAAGAGAGAGG
+7B, GAAGATCTTGCACAGCAGTGATTCAGTGAG
All cloning procedures were confirmed via automated sequencing (ABI
373; Applied Biosystems, Foster City, CA). During this conformation process, a PCR artifact (termed pMUT) was produced. In
this construct a single base pair change was introduced, disrupting a
putative C/EBP
binding site (Fig. 1).
|
Cell Culture and Transient Transfection. All cell culture medium and supplements were purchased from Invitrogen (Paisley, UK). HepG2 cells, a human hepatocyte carcinoma cell line, were obtained from the European Collection of Animal Cell Cultures (ECACC 85011430; Porton Down, Salisbury, UK). HepG2 cells were routinely cultured in 75 cm2-vented tissue culture flasks (Nunc; Fisher Scientific UK Ltd., Loughborough, Leicestershire, UK) using minimal essential medium with Earle's salts supplemented with 1% nonessential amino acids, 2 mM L-glutamine, 100 µg/ml gentamycin, and 10% Australasian fetal bovine serum. To maintain the phenotypic consistently of the HepG2 cells used, HepG2 cells were only used up to passage 13 after receipt from the European Collection of Animal Cell Cultures.
Transient transfection is based upon the calcium phosphate precipitation methodology of Jordan et al. (1996)
20°C for later assay of SEAP activity. Fresh medium was then added
to the wells and xenobiotic solution and solvent controls added as
required. Each experimental condition was carried out in eight separate
wells. Following 48 h of exposure to xenobiotic of solvent,
control medium was removed and stored at
20°C for later measurement
of SEAP activity.
SEAP Activity Determination. Aliquots of cell culture medium (25 µl/well) were transferred into 96-well Optiplates (Canberra Packard, Co, Pangbourne, UK). Endogenous alkaline phosphatase activity was deactivated by heat-treatment of the medium at 65°C for 30 min. SEAP activity was then assayed using the AURORA system (ICN, Thame, Oxon, UK), according to the manufacturer's protocol. Chemiluminescent output was measured using a LumiCount automated plate reader (Canberra Packard).
Data Analysis. The relative change in SEAP activity between day 3 (before inducer addition) and day 5 (after inducer addition) was calculated for pWT, pMUT, and pCMV (control, reporter vector minus insert) in the presence and absence of xenobiotic. These measurements allow for the control of variation in cell seeding, transfection efficiency, cytotoxicity, or cell proliferative effects of xenobiotics that might otherwise produce anomalous results.
A specific chemical effect was calculated using the values mentioned above and the statistical significance of this value over solvent control tested as described in Plant et al. (2000)Nuclear Protein Extraction.
Nuclear protein extracts were isolated according to the protocol of
Dignam et al. (1983)
. Briefly, HepG2 cells were grown to approximately
90% confluence and then collected by trypsinization. Cells were
pelleted by centrifugation (1300g for 5 min) and washed twice with phosphate-buffered saline. After the second wash, cells were
resuspended in 5 × packed cell volume of ice-cold
phosphate-buffered saline. Cells were pelleted and resuspended in
2 × packed cell volume of buffer A (10 mM Hepes-KOH, pH 7.9, 1.5 mM MgCl2, 10 mM KCI, 0.5 mM DTT). Cells were then
left to swell on ice for 10 min before disruption using a Dounce
homogenizer and pelleted by centrifugation (2000g for 15 min). The resulting pellet was resuspended in 0.5 × packed
nuclear volume (homogenate volume-supernatant volume) of buffer C
(25% glycerol, 20 mM Hepes-KOH, pH 7.9, 1.5 mM
MgCl2, 0.2 mM EDTA, 20 mM NaCl, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride). 0.5 × packed nuclear volume of
high salt buffer (buffer C containing 1.2 M NaCl) was then added
dropwise with swirling, and the suspension homogenized with a Dounce
homogenizer. The resulting homogenate was centrifuged at
16000g for 30 min, and the supernatant (nuclear protein)
aliquoted and stored at
80°C. Protein concentration was determined
by a modification of the method of Stoscheck (1990)
and integrity
assessed by SDS-polyacrylamide gel electrophoresis. Each aliquot was
taken through only three freeze/thaw cycles to maintain protein integrity.
DNase I Footprinting Assay.
Radiolabeled probe was prepared by initial PCR amplification of the
30l bp
+7 bp region of the CYP3A4 promoter using the primers above.
Dephosphorylated amplicons were 5' labeled with [
32P]ATP (110TBq/mmol; Amersham Biosciences
UK, Ltd., Little Chalfont, Buckinghamshire, UK) for 60 min at 37°C
using T4 polynucleotide kinase (Promega, Chilworth Science
ParkSouthampton, UK), and restriction digestion was then carried out to
remove one labeled end, creating either labeled-upper or -lower strand
probe. This probe was further purified by phenol/chloroform extraction
and ethanol precipitation. DNase I footprinting was carried out using
the Promega core footprinting system according to the manufacturer's
instructions. Samples were Cerenkov counted to ensure equal loading,
heat-denatured, and then separated on a 6% denaturing polyacrylamide
gel and opposed to X-OMAT LS film (Kodak Ltd., Hemel Hempstead, Herts,
UK) for 16 h.
Electromobility Shift Assay (EMSA).
Dephosphorylated oligomers were 5' labeled with
[
32P]ATP (~10 TBq/mmol, Amersham
Biosciences UK, Ltd.) for 60 min at 37°C using T4 polynucleotide
kinase (Promega, UK). Nonincorporated nucleotides were then removed by
ethanol precipitation. All binding reactions were carried out at room
temperature (22°C) and comprised binding buffer (20 mM Tris-HCl, pH
7.9, 50 mM NaCl, 10% glycerol, 0.1 mM DTT), 50 µg/ml poly-dI/dC and
a 14-µg nuclear protein. The reaction was allowed to proceed for 10 min and then 35 fmol of labeled probe was added (plus unlabeled
competitor where appropriate) and allowed to proceed for a further 30 min. Samples were then separated on a 4% nondenaturing polyacrylamide
gel and opposed to X-OMAT LS film for 16 h. Oligomers used for
EMSA assays are as described below, with the alternate base underlined,
EMSA Quantitation. EMSA reactions were exposed until all bands were within the linear range of the film and then bands quantified using video-based computerized densitometry on an minimal clinically important difference image analysis system (Imaging Research, Ontario, Canada).
| |
Results |
|---|
|
|
|---|
Mutation Characterization.
Both the promoter sequences (wild-type and HNF-3/CEBP
mutant) were
confirmed by automated sequencing (PE ABI 373; University of Surrey
Sequencing Facility) following cloning into the pSEAPpro2 plasmid. As
shown in Fig. 1, the mutation causes a T
C transition in the DNA
sequence at position
190 bp. Binding sites for transactivating factors were assigned using the Alibaba 2.1 (http://wwwiti.cs.unimagdeburg.de/~grabe/alibaba2/) to search the
TRANSFAC database (http://www. transfac.gbf.de/tranfac; Wingender et
al., 1996
). These assignments are shown in Fig. 1. DNase I footprinting
studies demonstrated that DNA-protein interactions occurred at the
computer-predicted sites (data not shown).
DNase I Footprinting Assay.
To examine how this mutation affected binding of transactivating
factors to the CYP3A4 promoter, a DNase I footprinting assay was
carried out using HepG2 nuclear protein extract, to identify the areas
of DNA-protein interaction within this region. Figure 2 shows the DNA footprint of the top
strand of wild-type sequence when exposed to nuclear protein extract
from uninduced HepG2 cells. Previous experiments have demonstrated that
the footprint obtained with HepG2 nuclear proteins is qualitatively
identical to that observed with nuclear proteins isolated from human
liver (data not shown). It can clearly be seen that several protected
footprints occur and these correspond to the computer predicted binding
sites for PXR and HNF-3/CEBP
. DNase I footprinting carried out on
the mutant sequence with uninduced HepG2 nuclear extract showed
identical binding over the region investigated showing that the point
mutation does not cause a qualitative change in binding at
the HNF-3/CEBP
interaction site (data not shown).
|
Electromobility Shift Assay.
To investigate whether the point mutation caused a quantitative change
in binding, as opposed to a qualitative one, EMSA was carried out using
oligomers covering the mutation site, as described under
Materials and Methods. Binding of HepG2 uninduced nuclear extract to the wild-type oligomer was competed with either an excess of
unlabeled wild-type or mutant oligomer. As can be seen from Fig.
3, the mutant oligomer has a
significantly weaker competitive effect than the wild-type oligomer,
demonstrating that binding of nuclear proteins to the complex
HNF-3/CEBP
site is at a higher affinity in the wild-type sequence as
opposed to the mutant sequence. Hence, a clear quantitative
difference was observed in the binding of nuclear protein to the
wild-type and mutant sequences.
|
Functional Analysis.
To investigate the functional impact of the mutation on expression of
the CYP3A4 gene, secretory alkaline phosphatase reporter gene
constructs were made containing the region
301 bp
+7 bp, from both
wild-type and the mutant variation. Experiments were carried out this
short region of the CYP3A4-flanking DNA, as this removed possible
complication due to transactivating factor cross talk, and also
corresponds to the region previously defined as the basal transcription
unit by Goodwin and colleagues (Goodwin et al., 1999a
). The reporter
gene constructs were tested over a full concentration response curve
with the glucocorticoid hydrocortisone, its synthetic analog
dexamethasone, and the potent PXR-ligand rifampicin. Figure
4 shows the result of these experiments.
All three compounds produced a concentration-dependent, statistically significant, induction of the pWT reporter gene construct,
demonstrating that this region is sufficient for, at least partial,
induction of the CYP3A4 gene. However, for the pMUT mutant reporter
gene, only rifampicin produced the same profile observed with the
pWT construct. For both dexamethasone and hydrocortisone, the observed EC50 remained the same as that seen using pWT,
but the maximal induction observed
(Imax) was reduced by 29 and 57%,
respectively, compared with pWT, leading to corresponding decreases in
IA values (Fig. 4).
|
| |
Discussion |
|---|
|
|
|---|
The use of reporter gene constructs is becoming an increasingly
important tool for dissection of the molecular mechanisms of gene
induction by xenobiotics. Many labs, including ours, have developed
such reporter gene systems to study the response of the CYP3A4 promoter
to exposure to xenobiotics. Our original system relies upon the ~1k
bp region of the proximal promoter originally cloned by Hashimoto et
al. (1993)
. Using this system, we have demonstrated induction of the
CYP3A4 gene by both xenobiotics (Ogg et al., 1999
) and endogenous
compounds (El-Sankary et al., 2000
). In the current study, we have used
a smaller region of the proximal promoter, covering the first 30l bp.
Previously, Barwick and colleagues (Barwick et al., 1996
) have
demonstrated that 179 bp of CYP3A4 proximal promoter is the minimum
required to achieve transcriptional activation in response to a number of xenobiotics in both rat and rabbit hepatocytes, when linked to a
heterologous promoter. In comparison, Goodwin et al. (1999b)
demonstrated 362 bp of CYP3A4 proximal promoter, linked to the endogenous CYP3A4 enhancer element the xenobiotic responsive enhancer module to be able to act as a xenobiotic responsive region when transfected into HepG2 cells. We now confirm this observation in HepG2
cells, showing 301 bp of CYP3A4 proximal promoter to be sufficient to
act as basal transcription unit, and mediate induction of the CYP3A4
reporter gene by compounds previously shown to activate the 1105 bp
proximal promoter reporter gene [rifampicin, dexamethasone,
hydrocortisone, and estrogen; data not shown for estrogen (Ogg et al.,
1999
)]. It is of interest to note that the EC50
value obtained by Goodwin and colleagues is significantly less than
that observed in this study (2 versus 12 µM). Such a difference
probably reflects the difference between a system using the native PXR
enhancer (xenobiotic responsive enhancer module) as compared with a
heterologous promoter. However, it should be noted that we have
previously demonstrated that cotransfection with expression plasmids
for hGR and hPXR results in a lowered observed
EC50 of 2 µM, in concordance with the
observations of Goodwin (El-Sankary et al., 2001
). Such data emphasizes
the importance of the receptor complement within a given cell system in
determining the overall effect. All experiments in the current study
were carried out in basal HepG2 cells (i.e., without additional
receptor expression plasmids). To ensure that an excess of any single
receptor did not cause ligands to act through pathways they do not
activate at physiological concentration of receptors. Such an approach has been validated by our previous demonstration of such a basal system
to respond to a wide range of CYP3A4 gene transcriptional activators.
Furthermore, we have generated a single base-pair mutant of the CYP3A4
gene that demonstrates an altered response to glucocorticoids but no
alteration in response to rifampicin. This is of particular interest as
recent evidence has suggested that glucocorticoid induction of the
CYP3A4 gene is regulated not via direct interaction of GR with the
CYP3A4 promoter but through activation and up-regulation of the steroid
hormone nuclear receptor PXR (Pascussi et al., 2000a
). Our data
suggests this latter hypothesis to be incomplete, as the mutation
described herein affects glucocorticoid-mediated gene expression but
not rifampicin-mediated, the latter representing a classical PXR ligand.
Following demonstration of the functional effect of this artificial
mutant, we examined the DNA-protein interactions behind this effect.
DNase I footprinting experiments showed that a DNA-protein interaction
did occur at the mutation site, and computer analysis suggested this to
be a complex HNF-3/CEBP
binding site. In addition to demonstrating
the interaction, footprinting studies showed no qualitative alteration
in nuclear protein binding at this site in the mutant, compared with
the wild-type sequence. However, electromobility shift assays showed
that nuclear protein binding at the mutant sequence was at a lower
affinity than at the wild-type sequence. Such a lowered affinity is
consistent with the functional data and suggests that the putative
HNF-3/CEBP
binding acts as a positive regulator of
glucocorticoid-mediated regulation of CYP3A4 gene expression.
The role of C/EBP
in regulating CYP3A4 gene expression has
previously been investigated, demonstrating that C/EBP
, along with D
element binding protein was capable of increasing the basal expression
of a
169 bp
+11 bp fragment of the CYP3A4 promoter (Ourlin et al.,
1997
). Whereas our observed mutation lies outside the core C/EBP
recognition site, effects on it cannot be excluded as several studies
have shown that nucleotides immediately 5' to a recognition sequence
also play a role in transcription factor binding (Juge-Aubry et al.,
1997
; Osada et al., 1997
; Driscoll et al., 1998
). C/EBP
could
potentially act as a bridging factor for interaction of other
transcription factors (e.g., GR) with the basal transcription
machinery, and it is well established that CBP/p300 interacts with
C/EBP
in this role (Kino et al., 1999
). An alternative activation
route is through interaction with the HNF-3 portion of this complex
binding site. HNF-3 has been implicated in the regulation of the
tyrosine aminotransferase gene, a classically glucocorticoid-induced
gene. Roux and colleagues (Roux et al., 1995
) clearly demonstrated that
HNF-3, acting via complex, overlapping recognition sites, is capable of
controlling the magnitude of TAT gene expression to glucocorticoids.
Hence, HNF-3 could act as a controller of nonPXR-mediated
glucocorticoid-induced induction of the CYP3A4 gene, producing an
increased induction above that seen with PXR alone.
We would therefore propose that regulation of CYP3A4 gene expression by
glucocorticoids involves a second site within the CYP3A4 proximal
promoter besides the PXRE. This site may function independently of or
as a modulator of the PXR-mediated induction. This induction most
likely occurs via activation of GR, followed by one of two possible
activation routes. First, binding of GR to a nonconsensus GRE may
occur. It is interesting to note that such interactions have previously
been demonstrated at specificity protein 1 (Sp1) sites (Bamberger et
al., 1996
); computer and DNase I footprinting analysis suggest two
putative simian virus 40 promoter factor 1 sites are present within the
301 bp
+7 bp region of the CYP3A4 promoter (data not shown). GR
binding to the promoter could then cause an increase in binding of the
basal transcriptional machinery, with C/EBP
and CBP/p300 acting as
established-bridging molecules or HNF-3 as a regulator of the magnitude
of effect. An alternative route would be through indirect action of GR,
through induction of the factors (HNF-3 and/or C/EBP
) binding to
this region of the proximal promoter. GR has been previously implicated in the induction of other receptors involved in glucocorticoid-mediated induction, specifically CAR, retinoid X receptor
, and PXR (Pascussi et al., 2000a
,b
).
In conclusion, we have demonstrated that expression of this clinically
important gene is tightly regulated by endogenous steroids, emphasizing
the importance of its role in steroid homeostasis. In addition, we
hypothesize that this regulation occurs not only through the previously
demonstrated activation of the steroid hormone receptor PXR, the major
controller of CYP3A4 gene expression, but via a PXR-independent
pathway. This pathway involves HNF-3 and/or C/EBP
activation and, we
hypothesize, binding of GR at a nonconsensus GRE. Such data are
extremely important in understanding the way this enzyme is regulated
by the body and how clinical intervention may affect this.
| |
Footnotes |
|---|
Received February 6, 2002; accepted June 11, 2002.
The first two authors contributed equally to the manuscript.
Address correspondence to: Dr. Nick Plant, Molecular Toxicology Group, School of Biomedical and Life Sciences, University of Surrey, Guildford, Surrey, GU2 7XH, UK. E-mail: n.plant{at}surrey.ac.uk
| |
Abbreviations |
|---|
Abbreviations used are:
P450, cytochrome P450;
bp, base pair(s);
HNF, hepatocyte-nuclear-factor;
GR, glucocorticoid
receptor;
GRE, glucocorticoid response element;
PXR, pregnane X
receptor;
CAR, constitutive androstane receptor;
C/EBP
, CCAAT-enhancer binding protein
;
SEAP, secreted alkaline
phosphatase;
PCR, polymerase chain reaction;
DTT, dithiothreitol;
EMSA, electromobility shift assay;
IA, inductive ability.
| |
References |
|---|
|
|
|---|
expression in human hepatocytes: synergistic increase of CYP3A4 induction by pregnane X receptor.
Mol Pharmacol
58:
361-372This article has been cited by other articles:
![]() |
R. Hermann, W. Siegmund, T. Giessmann, K. Westphal, A. Weinbrenner, B. Hauns, F. Reutter, G. Lahu, K. Zech, and T. D. Bethke The Oral, Once-Daily Phosphodiesterase 4 Inhibitor Roflumilast Lacks Relevant Pharmacokinetic Interactions With Inhaled Budesonide J. Clin. Pharmacol., August 1, 2007; 47(8): 1005 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tegude, A. Schnabel, U. M. Zanger, K. Klein, M. Eichelbaum, and O. Burk Molecular Mechanism of Basal CYP3A4 Regulation by Hepatocyte Nuclear Factor 4{alpha}: Evidence for Direct Regulation in the Intestine Drug Metab. Dispos., June 1, 2007; 35(6): 946 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jose, K. Saravu, and B. A. Shastry Atorvastatin-induced early-onset rhabdomyolysis in a patient with nephrotic syndrome Am. J. Health Syst. Pharm., April 1, 2007; 64(7): 726 - 729. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aouabdi, G. Gibson, and N. Plant TRANSCRIPTIONAL REGULATION OF THE PXR GENE: IDENTIFICATION AND CHARACTERIZATION OF A FUNCTIONAL PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR {alpha} BINDING SITE WITHIN THE PROXIMAL PROMOTER OF PXR Drug Metab. Dispos., January 1, 2006; 34(1): 138 - 144. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Roymans, P. Annaert, J. Van Houdt, A. Weygers, J. Noukens, C. Sensenhauser, J. Silva, C. Van Looveren, J. Hendrickx, G. Mannens, et al. EXPRESSION AND INDUCTION POTENTIAL OF CYTOCHROMES P450 IN HUMAN CRYOPRESERVED HEPATOCYTES Drug Metab. Dispos., July 1, 2005; 33(7): 1004 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sugatani, S. Nishitani, K. Yamakawa, K. Yoshinari, T. Sueyoshi, M. Negishi, and M. Miwa Transcriptional Regulation of Human UGT1A1 Gene Expression: Activated Glucocorticoid Receptor Enhances constitutive Androstane Receptor/Pregnane X Receptor-Mediated UDP-Glucuronosyltransferase 1A1 Regulation with Glucocorticoid Receptor-Interacting Protein 1 Mol. Pharmacol., March 1, 2005; 67(3): 845 - 855. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bombail, K. Taylor, G. G. Gibson, and N. Plant ROLE OF Sp1, C/EBP{alpha}, HNF3, AND PXR IN THE BASAL- AND XENOBIOTIC-MEDIATED REGULATION OF THE CYP3A4 GENE Drug Metab. Dispos., May 1, 2004; 32(5): 525 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Faucette, H. Wang, G. A. Hamilton, S. L. Jolley, D. Gilbert, C. Lindley, B. Yan, M. Negishi, and E. L. LeCluyse REGULATION OF CYP2B6 IN PRIMARY HUMAN HEPATOCYTES BY PROTOTYPICAL INDUCERS Drug Metab. Dispos., March 1, 2004; 32(3): 348 - 358. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, S. R. Faucette, D. Gilbert, S. L. Jolley, T. Sueyoshi, M. Negishi, and E. L. LeCluyse Glucocorticoid Receptor Enhancement of Pregnane X Receptor-Mediated CYP2B6 Regulation in Primary Human Hepatocytes Drug Metab. Dispos., May 1, 2003; 31(5): 620 - 630. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||