![]() |
|
|
Department of Xenobiotic Metabolism and Disposition, Minase Research Institute, Ono Pharmaceutical Co., Ltd., Osaka, Japan (K.N.); and Division of Cancer Biology and Genetics, Queen's University Cancer Research Institute, Queen's University, Kingston, Ontario, Canada (C.E.G., D.Z., S.P.C.C., R.G.D.)
(Received December 10, 2002; accepted April 14, 2003)
| Abstract |
|---|
|
|
|---|
Despite a high level of sequence conservation, the murine ortholog of MRP1,
mMRP1, differs from the human protein with respect to its ability to confer
resistance to anthracyclines and to transport the conjugated estrogen
E217ßG (Stride et al.,
1996
,
1997
). Thus, the mouse protein
fails to confer resistance to several commonly used anthracyclines and
transports E217ßG very poorly. These differences place some
limits on the usefulness of the mouse as a preclinical model for the
development of agents that might be used to selectively reverse drug
resistance mediated by MRP1. To date, the substrate specificity of other
mammalian MRP1 orthologs has not been characterized in any detail. However,
bovine MRP1 (bMRP1) has been cloned recently, and the drug resistance
phenotype of transfected cell lines was found to be similar to that of hMRP1
except that the bovine protein, like the murine protein, conferred no
resistance to doxorubicin (Taguchi et al.,
2002
). In addition, VP-16 resistance conferred by the bovine
protein was higher than that conferred by hMRP1. Since rats are widely used as
experimental models at the preclinical drug development stage, we have cloned
the MRP1 ortholog from skeletal muscle of Sprague-Dawley (SD) rats and
directly compared its functional characteristics with hMRP1 and mMRP1. During
preparation of this manuscript, the sequence of a rMRP1 cDNA, cloned from
brain astrocytes derived from SD rats was reported
(Yang et al., 2002
).
Characterization of the encoded rMRP1 was limited to a demonstration that
Madin-Darby canine kidney cells transiently transfected with an
rMRP1-expressing plasmid accumulated less calcein, a fluorescent MRP1
substrate, and that the accumulation deficit could be reversed by the MRP1
inhibitors indomethacin or MK571. Here, we have used the full-length rMRP1
cDNA cloned from skeletal muscle to generate stable transfectants of human
embryonic kidney cells (HEK293). The pharmacological phenotypes of clonal
populations of transfected cells were then characterized with respect to their
resistance to a number of chemotherapeutic agents. In addition, we have
examined the transport of potential physiological substrates, including
LTC4, E217ßG, and estrone 3-sulfate and identified
nonconserved amino acids that contribute to different substrate specificities
among the human and rodent MRP1 orthologs.
| Materials and Methods |
|---|
|
|
|---|
Cloning and Sequencing Analyses of rMRP1. Approximately 920,000
plaques from a rat skeletal muscle 5'-stretch plus cDNA library from BD
Biosciences Clontech (Palo Alto, CA) were screened under high stringency
conditions with a mMRP1 full-length cDNA
(Sambrook et al., 1989
). An
additional 3,300,000 plaques were screened with a murine cDNA probe extending
from nucleotides 1 to 460 of the coding region. Seven positive cDNA clones
were selected, and the plaques purified, DNA isolated, and the cDNA inserts
subcloned into a pBluescriptII KS+ vector (Stratagene, La Jolla,
CA). The cDNAs were sequenced using a 7-Deaza-dGTP Cy5/5.5 Dye Primer Cycle
Sequencing kit (Visible Genetics Inc., Toronto, ON, Canada) or a Thermo
Sequenase Cy5/Cy5.5 Dye Terminator kit (Amersham Biosciences Inc.) according
to the manufacturer's instructions. Some sequencing was obtained from Cortec
DNA Service Laboratories Inc. (Kingston, ON, Canada)
Northern Blot Analysis. Total RNA and poly(A)+ RNA from
SD rat tissues were purchased from BD Biosciences Clontech. Total RNA from the
murine myoblast cell line Sol8 was obtained by extraction with TRIzol reagent
(Invitrogen, Burlington, ON, Canada). RNA was resolved by electrophoresis on
formaldehyde/agarose denaturing gels and transferred to Hybond-XL membrane
(Amersham Biosciences Inc.) and probed under standard conditions
(Sambrook et al., 1989
). Blots
were probed with a putative rMRP1 full-length cDNA (nucleotides -1 to 4608)
and a cDNA corresponding to human glyceraldehyde-3-phosphate dehydrogenase
(GAPDH).
Construction of a rMRP1 Expression Vector. The episomal expression
vector pCEBV7 (PC7) was used previously to make cell lines expressing hMRP1
and mMRP1 (Wilson and Deeley,
1995
; Stride et al.,
1997
). Consequently, we inserted the rat cDNA into this vector for
transfection into HEK293 cells. To facilitate cloning and optimal expression,
a NotI restriction site and a consensus Kozak sequence (underlined)
was added to the 5'-end of the rat coding sequence
(GCGGCCGCCATGGCGCTGAGC) and an XhoI site (underlined) to
the 3'-end (TGAACTGATCTCGAG) by PCR. The rat cDNA sequence
inserted included the entire coding sequence and an additional nine
nucleotides of 3'-untranslated sequence. The integrity of the cloning
sites and the region amplified by PCR were confirmed by sequencing.
Site-Directed Mutagenesis and Construction of Expression Vectors of Mutant rMRP1. The template for mutagenesis was prepared by subcloning a 1.5-kb HindIII-EcoRI fragment of rMRP1 that contains nucleotides 28754551 and encodes amino acids 959-1517 into pBluescript KS+. Mutagenesis was subsequently carried out using the QuickChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions with the following sense (S) and antisense (AS) mutagenesis primers (substituted nucleotides are underlined): rMRP1L983M-S (5'-GAG TAT CTT CCT TTT CAT GTG CAA TCA TGT ATC TGC-3'), rMRP1L983M-AS (5'-GCA GAT ACA TGA TTG CAC ATG AAA AGG AAG ATA CTC-3'), rMRP1L1026S-S (5'-GGG CCT TGG GCA TCT CGC AAG GTG TGG CAG T-3'), rMRP1L1026S-AS (5'-ACT GCC ACA CCT TGC GAG ATG CCC AAG GCC C-3'), rMRP1Q1090E-S (5'-ACT CCA TGA TCC CGG AGG TCA TCA AGA TG-3'), rMRP1Q1090E-AS (5'-CAT CTT GAT GAC CTC CGG GAT CAT GGA GT-3'), rMRP1S1101N-S (5'-TGG GTT CAC TCT TCA ATG TCA TTG GAG CTG T-3'), rMRP1S1101N-AS (5'-ACA GCT CCA ATG ACA TTG AAG AGT GAA CCC A-3'), rMRP1V1106C-S (5'-CAG TGT CAT TGG AGC TTG CAT CAT CAT CCT ACT GGC-3'), rMRP1V1106C-AS (5'-GCC AGT AGG ATG ATG ATG CAA GCT CCA ATG ACA CTG-3'), rMRP1A1243T-S (5'-CTC ACT GCA GAT AAC TAC ATA CTT GAA CTG GC-3'), rMRP1A1243T-AS (5'-GCC AGT TCA AGT ATG TAG TTA TCT GCA GTG AG-3'). Cloning a HindIII-StuI fragment encompassing nucleotides 28753565 of rMRP1Q1090E into HindIII-StuI digested rMRP1A1243T generated the double mutant rMRP1Q1090E/A1243T. After confirming all mutations by sequencing or restriction enzyme digests, a 1.45-kb HindIII-SrfI fragment was subcloned into the wild-type rMRP1 expression vector. The fragments in the full-length constructs were again confirmed by sequencing.
Construction of Hybrid rMRP1/hMRP1 Expression Vectors. The chimeric expression vector encoding rMRP1/hMRP1 (9591531) was generated by ligating a HindIII-SfiI fragment encompassing nucleotides 28754823 of PC7-hMRP1 into HindIII-SfiI digested PC7-rMRP1. The vector encoding rMRP1/hMRP1 (11881531) was generated by ligating a StuI-SfiI fragment encompassing nucleotides 35624823 of PC7-hMRP1 into StuI-SfiI digested PC7-rMRP1. The vector encoding rMRP1/hMRP1 (9591187) was constructed by ligating a HindIII-StuI fragment encompassing nucleotides 28753562 of PC7-hMRP1 into HindIII-StuI digested pC7-rMRP1. Integrity of the hybrid constructs was confirmed by sequencing across cloning junctions or by restriction enzyme digests.
Creation of Cell Lines Stably Expressing rMRP1. HEK293 cells grown
in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum
were transfected with the rMRP1 expression vectors and cell lines expressing
rMRP1 selected with 100 µg/ml hygromycin B (Roche Applied Science, Laval,
PQ, Canada). Briefly, approximately 1.5 x 105 HEK293 cells
were seeded in each well of a 6-well plate and 24 h later, 1 µg of DNA and
3 µl of FuGENE 6 (Roche Applied Science) were mixed and added to the cells
according to the manufacturer's instructions. After 48 h, the transfected
cells were subcultured 1:3 and supplemented with fresh medium. The medium was
replaced with fresh medium containing 100 µg/ml hygromycin B 24 h later.
Approximately 14 days post-transfection, the hygromycin B-resistant cells were
seeded into 96-well plates at a density of 15 cells/plate. The cells were
selected in hygromycin B for a further 3 to 4 weeks. After expanding the
hygromycin-resistant clones, levels of MRP1 protein were determined by
immunodot blot analysis. In some cases, vectors were transiently tranfected
into HEK293 cells as follows. Approximately 1 x 107 cells
were seeded in 175-cm2 flasks, and 24 h later, 15 µg of DNA was
mixed with 45 µl of FuGENE 6 according to the manufacturer's instructions.
After 48 to 72 h, HEK293 cells were harvested, and inside-out membrane
vesicles were prepared as described previously
(Loe et al., 1998
).
Measurement of Protein Levels in Transfected Cells. The levels of
MRP1 proteins were determined by immunoblot analysis of membrane protein
fractions from transfected cells. After determination of protein levels by
Bradford assay (Bio-Rad, Hercules, CA), proteins were resolved by
SDS-polyacrylamide gel electrophoresis (7.5% gel) and subsequently transferred
to Immobilon-P polyvinylidene difluoride membranes (Millipore Corporation,
Bedford, MA) by electroblotting. Rat MRP1, hMRP1, and mMRP1 proteins were
identified using the monoclonal antibody (mAb) MRPr1 (Alexis Biochemicals, San
Diego, CA). This mAb recognizes a linear epitope of 10 amino acids in hMRP1,
238GSDLWSLNKE, nine of which are conserved in both mMRP1 and rMRP1
(Hipfner et al., 1998
)
(Fig. 1). Antibody binding was
detected with horseradish peroxidase-conjugated goat anti-rat IgG (Pierce
Chemical, Rockford, IL) followed by enhanced chemiluminescence detection
(PerkinElmer Life Sciences, Boston, MA) and densitometry of the X-ray
film.
|
Chemosensitivity Testing. Drug resistance was determined using the
colorimetric 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
(MTT) assay as described previously
(Stride et al., 1997
). Mean
values of quadruplicate determinations (± S.D.) were plotted using
GraphPad software (GraphPad Software, Inc., San Diego, CA). IC50
values were obtained from the best fit of the data to a sigmoidal curve.
Relative resistance factors are expressed as the ratio of the IC50
value of cells expressing rMRP1, hMRP1, or mMRP1 to the IC50 value
of cells stably transfected with the empty vector PC7. Resistance was
determined in four separate concurrent experiments.
Transport by Membrane Vesicles. Plasma membrane vesicles were
prepared as described previously (Loe et
al., 1998
) and ATP-dependent transport of
[3H]LTC4 into the inside-out membrane vesicles at
23°C was measured by a rapid filtration technique (Loe et al.,
1996a
,b
;
Qian et al., 2001
). All data
were corrected for the amount of [3H]LTC4 that remained
bound to the filter, which was usually <5% of the total radioactivity.
ATP-dependent uptake of [3H]E217ßG (400 nM, 32 nCi
per time point) and [3H]estrone 3-sulfate (300 nM, 40 nCi per time
point in the presence or absence of 1 or 3 mM GSH) were measured as described
for [3H]LTC4 except that the reactions were carried out
at 37°C. Kinetic parameters of estrone 3-sulfate transport were determined
by measuring the initial rate of [3H]estrone 3-sulfate uptake (in
the presence or absence of 1 mM GSH) at eight different substrate
concentrations between 0.15 and 16 µM. The amount of protein used in the
assay varied from 2 µg/time point for membrane vesicles containing human
MRP1 to 4 µg/time point for vesicles containing the rat or murine protein.
Transport in the presence of AMP was subtracted from transport in the presence
of ATP and reported as ATP-dependent uptake. For each substrate concentration,
ATP-dependent uptake was measured at a single time point of 1 min.
Km and Vmax were determined using a
Hanes-Woolf plot and Vmax was then corrected for relative
MRP1 protein expression levels.
| Results |
|---|
|
|
|---|
The two SD rMRP1 cDNA sequences encode potential open reading frames of 1532 amino acids and differ at only three locations. The first at position 4 of the open reading frame of the astrocyte-derived sequence is an Arg, as it is in both hMRP1 and mMRP1, whereas our rMRP1 sequence derived from skeletal muscle encodes a Ser at this location. In contrast, the Ser1382 of the skeletal muscle rMRP1 sequence is also a Ser in the partial rMRP1 sequence and in the mouse and human sequences but is a Pro residue in the sequence derived from rat astrocytes. This could be a significant change since it occurs in the second nucleotide binding domain (NBD2) between the conserved Walker A and ATP-binding cassette signature motifs. Similarly, Ile1473 of the skeletal muscle sequences is Ile in the partial rMRP1 sequence, hMRP1, and mMRP1 but is Val in the rMRP1 sequence from astrocytes. This conservative substitution is located just downstream of the Walker B motif in NBD2. At the moment, however, it is unclear whether these are genuine sequence polymorphisms or are the result of cloning artifacts.
Overall, the two deduced amino sequences for rMRP1 are 88 and 86.8%
identical to hMRP1 (for skeletal muscle- and astrocyte-derived MRP1,
respectively) and 95% identical to mMRP1
(Fig. 1)
(Cole et al., 1992
;
Stride et al., 1996
;
Yang et al., 2002
). When
compared with hMRP1, rMRP1 and mMRP1 contain an additional Pro residue after
amino acid 279 in the predicted third cytoplasmic loop (CL3) of MRP1.
Additional Arg and Pro residues are also present after amino acid 1002 of the
human sequence in rMRP1 and mMRP1, respectively. These residues are located in
the first extracellular loop of membrane-spanning domain (MSD) 3. Lys 941 of
hMRP1, present in the cytoplasmic linker region connecting NBD1 and MSD3, is
absent in both the rat and mouse proteins. Mouse MRP1 lacks another single
amino acid found at position 641 of hMRP1, which is located in NBD1. The
residue is a Thr in hMRP1 and a Met in rMRP1. Mouse MRP1 is missing a further
three amino acids that would correspond to hMRP1 amino acids 883885
which are also located in the linker region connecting NBD1 to MSD3. These
residues are Val-Thr-Gly in hMRP1 and Lys-Asn-Gly in rMRP1. In the human
protein, this region can be deleted with no loss of LTC4 transport
activity (Gao et al.,
1998
).
Tissue Distribution of Rat MRP1 mRNA Expression. The rMRP1 cDNA containing nucleotides -1 to 4608 was used to probe a Northern blot of rat tissues. Expression of rMRP1 was detected in poly (A)+ RNA isolated from skeletal muscle, brain, heart, spleen, lung, and kidney (Fig. 2). Under the conditions used, expression was not detected in liver.
|
The mRNA species detected appeared larger than previously reported for
mMRP1 mRNA, which was estimated to be 6.0 to 6.2 kb
(Stride et al., 1996
). A
direct comparison was carried out by probing a northern blot of total rat
kidney RNA together with total RNA from the murine myoblast cell line, Sol 8,
using the rMRP1 cDNA as probe. Consistent with previous reports of the size of
mMRP1 mRNA, the probe hybridized with a mRNA of approximately 6.0 kb in RNA
from the Sol 8 cell line. In the RNA from rat kidney, a single mRNA species
was detected that was considerably larger than the mMRP1 mRNA and was
estimated to be approximately 7.5 kb. Thus, the two rodent mRNAs differ
considerably in the length of their untranslated sequence.
Stable Expression of rMRP1 in HEK Cells. An episomal vector
containing an expression cassette for rMRP1 was constructed as previously
described for hMRP1 and mMRP1 and used to transfect HEK293 cells
(Stride et al., 1997
).
HEKrMRP1 subpopulations were isolated by limiting cell dilution and
screened for the level of rMRP1 expression. Those populations that expressed
levels of rMRP1 approximately equivalent to the levels of mMRP1 and hMRP1 in
previously characterized HEK transfectants were used for further studies.
Immunoblot analysis of membrane-enriched fractions with mAb MRPr1 confirmed
that the PC7-rMRP1-encoded protein comigrated with hMRP1 and mMRP1
(Fig. 3). Under the conditions
used for immunoblotting, no endogenous hMRP1 was detected in cells transfected
with parental vector (HEKPC7).
|
Comparison of Drug Resistance Profiles of HEKrMRP1, HEK-mMRP1, and HEKhMRP1. Cell populations expressing human, mouse and rat proteins were tested concurrently for their resistance to a number of drugs using an MTT assay. Typical dose-response curves for cells exposed to vincristine, VP-16, doxorubicin, daunorubicin, and epirubicin are shown in Fig. 4, and a summary of the relative resistance factors determined from four separate concurrent experiments is shown in Table 1. HEKrMRP1 conferred moderate resistance (7.0-fold) to vincristine as compared with hMRP1 (10.9-fold) and mMRP1 (11.7-fold). Resistance conferred by rMRP1 to VP-16 was also moderate (6.1-fold) when compared with that conferred by hMRP1 (9.0-fold) or mMRP1 (18.7-fold). As we have reported previously, mMRP1 did not confer resistance to the anthracyclines, doxorubicin, daunorubicin, and epirubicin (1.1, 1.2 and 0.7-fold, respectively), whereas cells expressing hMRP1 conferred resistance to all three anthracyclines (7.0, 5.5, and 5.5-fold, respectively). HEK-rMRP1 cells conferred no or very low resistance to doxorubicin, daunorubicin, and epirubicin (1.9-, 1.6-, and 1.0-fold, respectively). Thus, the anthracycline resistance profiles of rMRP1 were similar but not identical to those found for mMRP1.
|
|
LTC4 and E217ßG Transport Function of
rMRP1. The transport of LTC4 was examined using membrane
vesicles isolated from HEK transfectants stably expressing rMRP1, hMRP1, or
mMRP1. The data were then normalized for the relative expression levels of the
orthologs in the membrane vesicles, as determined by immunoblotting and
densitometry (shown in Fig. 3).
The time course of LTC4 uptake is shown in
Fig. 5A. The rates of
LTC4 transport calculated at the 1 min time point were similar for
all three proteins at 49.5, 48.2, and 42.0 pmol/mg/min for rMRP1, mMRP1, and
hMRP1, respectively (Fig. 5C).
The Km value for rMRP1 was 50 nM, which is similar to that
previously obtained for the human and mouse proteins (data not shown)
(Loe et al., 1996b
; Stride et
al., 1997
,
1999
).
|
Previously, we have shown that hMRP1 transports E217ßG
relatively efficiently while transport of this substrate by mMRP1 is very poor
(Stride et al., 1997
). Here,
we show that transport of E217ßG by HEKrMRP1
membrane vesicles was less than 10% that of HEKhMRP1 vesicles but
was similar to that of vesicles containing the mouse protein
(Fig. 5B). The ATP-dependent
transport calculated at the 1 min time point by HEKrMRP1,
HEKmMRP1, and HEKhMRP1 was 9.7 ± 1.6, 8.7
± 3.3, and 139.9 ± 22.7 pmol/mg/min, respectively. Transport
of [3H]LTC4 and
[3H]E217ßG by Hybrid and Mutant
Proteins. Previous studies demonstrated that murine/human hybrid proteins
in which amino acids 955-1184 or 11851528 of mMRP1 were replaced with
the corresponding region of hMRP1 transported E217ßG more
efficiently than the wild-type murine protein with no change in the efficiency
of LTC4 transport (Stride et
al., 1999
). To examine whether or not introduction of these
regions into rMRP1 enhanced E217ßG transport, we constructed
rat/human hybrid proteins that replaced amino acids 959-1532, 11881532
and 959-1188 of rMRP1 with the corresponding regions of hMRP1. The constructs
were transfected into HEK293 cells and after 4872 h, the cells were
harvested, the membrane vesicles prepared, and the relative MRP1 protein
levels determined by immunoblotting. Mean values of expression levels for all
constructs varied from 0.8 to 1.4 relative to rMRP1
(Fig. 6A). ATP-dependent
transport of [3H]LTC4 and
[3H]E217ßG was determined using the membrane
vesicles prepared from the transfected HEK293 cells
(Fig. 6, B and C).
LTC4 uptake by the membrane vesicles expressing rMRP1, hMRP1, and
hybrid rMRP1/hMRP1 was proportional to the relative expression levels of all
tested proteins, while transport of E217ßG by rMRP1 and the
rat/human hybrids was significantly impaired
(Fig. 6C). However,
E217ßG uptake in vesicles containing the COOH proximal half of
MRP1 (amino acids 959-1531) was easily detectable and was 50 to 60% that found
for hMRP1 and approximately 7-fold higher than the transport activity of
wild-type rMRP1. Hybrids containing MRP1 amino acids 959-1187 and
11881531 were less active but still displayed a 3- and 4-fold increase
in E217ßG transport, respectively, relative to rMRP1.
|
To further localize residues important for transport, the region encoding
TMs 1217 of human, murine, and rat MRP1 were compared. Residues that
are identical between murine and rat MRP1, but nonconservatively substituted
in hMRP1 were selected for analysis. Such amino acids in rMRP1 were
substituted with the corresponding residue from hMRP1, and membrane vesicles
were isolated from transiently transfected HEK293 cells. Expression levels of
the mutant proteins, which varied from 1.0 to 1.4 relative to rMRP1, are shown
in Fig. 6D. LTC4
uptake for the mutant proteins was proportional to their expression levels.
Therefore, LTC4 transport was unaffected by these mutations
(Fig. 6E). Similarly, mutations
L983M, L1029S, and V1106C had no effect on E217ßG transport
whereas S1101N increased the transport by approximately 50%
(Fig. 6F). However, the A1243T
mutation increased E217ßG uptake 3.7-fold relative to
wild-type rMRP1. This is similar to the increase found in the equivalent mMRP1
mutation, A1239T (Zhang et al.,
2001a
). A 2-fold increase in transport activity was also noted for
the Q1090E mutation. The same mutation in mMRP1, Q1086E, had no significant
effect on E217ßG transport. In addition, the double mutation
Q1090E/A1243T increased E217ßG transport 7.6-fold relative to
rMRP1. The equivalent double mutation in mMRP1, Q1086E/A1239T, did not
increase E217ßG transport beyond that obtained with the A1239T
mutation.
Transport of [3H]Estrone 3-Sulfate. MRP1 is expressed at
high levels in the testis in both humans and mice where it may play a role in
the efflux of steroid conjugates (Flens et
al., 1996
; Wijnholds et al.,
1998
). We have shown previously that hMRP1 is capable of
transporting estrone 3-sulfate, which is one of the more abundant estrogen
conjugates formed in the testis (Qian et
al., 2001
). However, transport of estrone 3-sulfate by hMRP1,
unlike E217ßG, is stimulated approximately 10-fold by GSH and
its other nonreducing derivatives, including S-methyl GSH. The
ability of murine and rat MRP1 to transport this estrogen conjugate and the
dependence of the transport on the presence of GSH has not been determined.
Consequently, we compared the ability of the three orthologs to transport
[3H]estrone sulfate in the absence and presence of GSH. In the
absence of GSH, transport activities obtained with HEKrMRP1,
HEKmMRP1, and HEKhMRP1 membrane vesicles were 5.7
± 3.0, 5.0 ± 2.6, and 6.5 ± 1.9 pmol/mg/3 min,
respectively (Fig. 7). In the
presence of 1 mM GSH, the transport activity of HEKrMRP1 and
HEKmMRP1 increased 3- to 4-fold to 24.3 ± 3.0 and 14.0
± 2.9 pmol/mg/3 min, respectively, while the transport activity of the
HEKhMRP1 vesicles increased approximately 9-fold to 57.6 ±
10.4 pmol/mg/3min (Fig. 7). Thus the basal rate of transport of this substrate by the rodent proteins
appears to be similar to that of the human protein. However, transport is 2-
to 3-fold less responsive to the presence of GSH than transport observed with
the human protein.
|
To determine the kinetic parameters of estrone 3-sulfate transport and the
effect of GSH, ATP-dependent uptake in the presence and absence of 1 mM GSH
was determined for a number of substrate concentrations ranging from 0.15 to
16 µM. A nonlinear regression analysis
(Fig. 7, B and C) and
Hanes-Woolf transformations (not shown) of the data yielded similar
Km and Vmax values. The
Km for hMRP1 was determined to be 0.83 µM in the
presence of GSH and 4.2 µM in the absence of GSH, consistent with the
Km values reported previously
(Qian et al., 2001
;
Zhang et al., 2001b
). The
Km values for mMRP1 and rMRP1 were either identical to
each other, 1.1 µM in the presence of GSH, or very similar to each other,
3.2 and 3.4 µM, respectively, in the absence of GSH. Thus, GSH increases
the apparent affinity of MRP1 for estrone sulfate approximately 5-fold in the
case of hMRP1 and 3-fold in the case of the rodent proteins. The
Vmax values obtained in the absence of GSH (corrected for
relative MRP1 protein expression) were 64, 85, and 109 pmol mg-1
protein min-1 for hMRP1, mMRP1, and rMRP1, respectively. In the
presence of GSH, the Vmax values were 144, 117, and 110
pmol mg-1 protein min-1 for hMRP1, mMRP1, and rMRP1,
respectively. Thus, GSH increased the Vmax for hMRP1 and
mMRP1 by 2.25 and 1.4 fold, respectively. No effect on the
Vmax of rMRP1 was detected. As an indicator of the overall
effect of GSH on the efficiency of estrone sulfate transport, the
Vmax/Km values for the human, mouse,
and rat protein increased 11.6-, 3.8-, and 3.2-fold, respectively.
To identify regions of the protein responsible for the difference in GSH dependence, we examined estrone 3-sulfate transport by the rat/human hybrid proteins. Two of them, rMRP1/hMRP1 (9591531) and rMRP1/hMRP1 (9591187), displayed a GSH dependence that was approximately equivalent to that of hMRP1 (Fig. 8A). The GSH dependence of the hybrid rMRP1/hMRP1 (11871531) was comparable with that of wild-type rMRP1. Thus, the region of the human protein that appears primarily responsible for its greater response to GSH is located between amino acids 959 and 1187. However, the two mutations that affected E217ßG transport, Q1090E and A1243T, and the double mutation, Q1090/A1243T, did not alter the GSH dependence or the basal rate of estrone 3-sulfate transport (Fig. 8A). Thus, different determinants appear to be important for transport of the two estrogen conjugates.
|
The Effect of Doxorubicin on Transport of Estrone 3-Sulfate.We have
shown previously that doxorubicin inhibits hMRP1-mediated transport of
LTC4 and E217ßG (Loe et al.,
1996b
,
1998
). To determine whether
doxorubicin also inhibits GSH-stimulated estrone 3-sulfate transport, membrane
vesicles from HEK293 cells transiently transfected with wild-type and hybrid
hMRP1 and rMRP1 expression vectors were tested in the standard vesicle
transport assay, with and without addition of 50 µM doxorubicin.
Doxorubicin inhibited estrone 3-sulfate transport in vesicles containing the
human protein by 70% while having no effect on transport by the rat protein,
consistent with the inability of rMRP1 to confer anthracycline resistance
(Fig. 8B). Significantly,
doxorubicin had a negative effect on transport of estrone 3-sulfate by all
three hybrid proteins although the most significant reduction in transport
occurred with the hybrid containing hMRP1 amino acids 959 to 1531 and 959 to
1187. This is consistent with our previous data showing that determinants of
doxorubicin resistance are found in the COOH-terminal third of hMRP1 and that
a particularly critical residue, Glu1089, is located between amino acids 959
and 1187 (Ito et al., 2001
;
Zhang et al., 2001b
).
Conversion of the corresponding residue in rMRP1 from glutamine to glutamate,
Q1090E, increased doxorubicin inhibition of estrone 3-sulfate transport so
that transport in the presence of drug was decreased by 50%, consistent with
this residue being involved in binding of anthracyclines
(Fig. 8B). The second mutation
tested, A1243T, also enhanced the ability of doxorubicin to inhibit estrone
3-sulfate transport but to a lesser extent than found for the Q1090E
mutation.
| Discussion |
|---|
|
|
|---|
The ability of hMRP1 to confer resistance to anthracyclines,
epipodophyllotoxins, and the Vinca alkaloids has been well
characterized (Cole et al.,
1994
; Grant et al.,
1994
; Zaman et al.,
1994
; Stride et al.,
1997
). In addition, we have shown that although the ability of
mMRP1 to confer resistance to VP-16 and vincristine is similar to that of
mMRP1, the mouse protein confers essentially no resistance to the
anthracyclines (Stride et al.,
1997
). Cell lines expressing bMRP1 also showed no resistance to
doxorubicin (Taguchi et al.,
2002
). Here we find that rMRP1 conferred moderate resistance to
both VP-16 and vincristine but no, or very low, resistance to doxorubicin,
daunorubicin, and epirubicin. Thus, the resistance profile of rMRP1 is similar
to that of mMRP1. We previously showed by site-directed mutagenesis that the
nonconserved Glu1089 in hMRP1, which corresponds to Gln1086 in mMRP1, is
critical for resistance to doxorubicin
(Zhang et al., 2001b
). In both
the bovine and rat proteins, the equivalent residue is Gln (Gln1088 in bMRP1
and Gln1086 in rMRP1) as it is in mMRP1
(Taguchi et al., 2002
). Thus,
there is a strong correlation between the presence of Gln at this location in
the protein and the inability of MRP1 to confer anthracycline resistance.
The efficiency with which the mouse, rat, and human MRP1s transport the
physiological substrates LTC4 and E217ßG were also
compared. Human and mouse MRP1s transport LTC4 with equal
efficiency, and no difference in the ability of rMRP1 to transport this
substrate was observed (Stride et al.,
1997
). In the case of E217ßG however, the level of
transport in the rMRP1 membranes was similar to that of mMRP1 and less than
10% that obtained for membranes containing hMRP1. We have recently identified
another conjugated estrogen, estrone 3-sulfate, that can be efficiently
transported by hMRP1, but in contrast to E217ßG, transport of
this compound is markedly stimulated by GSH
(Qian et al., 2001
). The
ability of the rodent MRP1 proteins to transport this substrate had not been
determined. We found that the basal rates of transport of estrone 3-sulfate
are comparable for all three proteins. However, at subsaturating
concentrations (300 nM), GSH stimulated rMRP1- and mMRP1-mediated transport 3-
to 4-fold compared with 9-fold stimulation for hMRP1. Kinetic analysis of the
three orthologs revealed that this difference in response is attributable to
differential effects of GSH on both Km and
Vmax. GSH decreased the Km for estrone
sulfate approximately 3-fold for both rodent proteins and 5-fold for hMRP1. In
addition, the Vmax of hMRP1 was increased more than 2-fold
compared with only 1.4-fold for mMRP1 and the Vmax of the
rat protein was unaffected. The reasons for the differences in GSH stimulation
are presently unknown. However, since they are apparent at saturating GSH
concentrations, it appears likely that a step after initial GSH binding is
involved. This is supported by our recent demonstration that a
photoactivateable derivative of GSH, azidophenacyl GSH, which can substitute
functionally for GSH, labels hMRP1 and mMRP1 comparably
(Qian et al., 2002
).
Functional differences between the mouse and human proteins have allowed us
to define domains and/or amino acid residues of MRP1 important for the ability
of the protein to confer anthracycline resistance and/or to transport
E217ßG. Using a strategy based on the functional
characterization of various hybrid proteins, we have identified individual,
nonconserved amino acids that are major determinants of substrate specificity
(Stride et al., 1999
; Zhang et
al.,
2001a
,b
,
2002
). Rat/human hybrid
proteins, like the comparable mouse/human hybrids, also showed that
E217ßG transport is partially restored by substitution of the
COOH-proximal third of the rat protein with the human sequence
(Stride et al., 1999
).
Division of this region to create hybrids containing amino acids 959 to 1187
or 1188 to 1531 of the human protein decreased transport without eliminating
it, suggesting that determinants for E217ßG transport are
present in both regions. A number of nonconservative differences in amino acid
sequence between mouse/rat and human MRP1 were tested for their effect on
LTC4 and E217ßG transport, including the rMRP1 TM14
and TM17 mutations Q1090E and A1243T. None of the mutations had any effect on
LTC4 transport. The rMRP1 TM17 A1239T mutation increased
E217ßG transport 4-fold. A similar effect on
E217ßG transport was noted for the corresponding mutation,
T1239A, in mMRP1. A 2-fold increase in transport was also found with the rMRP1
TM14 mutation, Q1089E, and the TM14/TM17 double mutant increased transport 7-
to 8-fold. This approaches the transport efficiency of hMRP1. In contrast, the
corresponding TM14 mutation in mouse and human MRP1s had no significant effect
on E217ßG transport over and above that noted for the TM17
mutation alone (Zhang et al.,
2001a
). Given that the sequences of TM14 and TM17 are identical in
rMRP1 and mMRP1, the differences with respect to E217ßG
transport suggest that other amino acids, that are not conserved between rat
and mouse proteins, may influence the interaction of the TM14 Glu with the
estrogen glucuronide. The only other mutation that affected
E217ßG transport by rMRP1 was also in TM14. This mutation,
L1101N, increased transport by approximately 50%.
Previously, we showed that the hMRP1 TM 14 mutations E1089Q and E1089K,
which either reduce or completely eliminate resistance to doxorubicin and
vincristine, had no effect on estrone 3-sulfate transport
(Zhang et al., 2001b
). Here we
show that the TM14 and TM17 mutations, as well as the TM14/TM17 double
mutation, which affect E217ßG transport, had no effect on
either the basal or GSH-stimulated transport of estrone 3-sulfate. Thus
despite the shared steroid nucleus, these residues are unlikely to form direct
interactions with the latter compound. However, the results of studies with
the rat/human hybrids clearly show that the GSH stimulation of estrone
3-sulfate transport can be rescued by substituting amino acids 959 to 1187 of
the rat protein with the corresponding region of the hMRP1, indicating that
different, nonconserved amino acids within this region contribute to the
greater efficiency with which hMRP1 transports the two estrogen
conjugates.
Previously, we have shown that chemotherapeutic agents, such as vincristine
and doxorubicin, can act as inhibitors of both LTC4 and
E217ßG transport by hMRP1, suggesting that they interact with
common or mutually exclusive portions of the substrate binding pocket(s) (Loe
et al.,
1996a
,b
,
1998
). When the ability of
doxorubicin to inhibit GSH-stimulated estrone 3-sulfate transport by the rat
and human proteins was directly compared, we found that a concentration of
drug, which inhibited transport by hMRP1 by approximately 70%, resulted in
only 20% inhibition of transport by rMRP1. This strongly suggests that the
decreased ability of the rat protein to confer resistance to the anthracycline
is attributable to a decreased ability to bind the drug. We found that all
three rat/human hybrid proteins, comparable with mouse/human hybrids that
restore doxorubicin resistance (Stride et
al., 1999
), also restore the ability of the drug to inhibit
transport, as did the single mutation in TM14, Q1086E, that is critical for
resistance to this class of drugs (Zhang
et al., 2001b
). In addition, the TM17 mutation A1239T that in the
mouse protein had no detectable effect on doxorubicin resistance
(Zhang et al., 2001a
), also
enhanced the ability of doxorubicin to inhibit transport by rMRP1. This
suggests, as observed with the different effect of the TM14 mutations on
E217ßG transport, that other amino acids, which are not
conserved between the rat and mouse proteins, may contribute to the binding of
anthracyclines and the estrogen glucuronide. Since GSH-stimulated transport of
estrone 3-sulfate was not affected by any of these mutations, the results
indicate that the binding of this estrogen conjugate must involve interaction
with a set of amino acid residues that is at least partially distinct from
those involved in binding the anthracyclines and E217ßG.
Overall, these studies serve to emphasize that the use of rodent models for preclinical testing of drugs targeted to MRP1, or for the investigation of drug disposition mediated by this transporter and possibly its homologues, should be accompanied by in vitro assays that permit comparison of the transport and/or binding characteristics of the test compound by both rodent and human proteins.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 Canada Research Chair in Cancer Biology and Senior Scientist of Cancer Care
Ontario. ![]()
2 Stauffer Research Professor of Queen's University. ![]()
3 Abbreviations used are: hMRP1, human multidrug resistance protein 1; bMRP1,
bovine MRP1; rMRP1, rat MRP1; GSH, glutathione; LTC4, leukotriene
C4; VP-16, etoposide; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; SD, Sprague-Dawley; HEK, human embryonic kidney; TMs,
transmembrane helices; E217ßG,
17ß-estradiol-17-(ß-D-glucuronide); PC7, episomal
expression vector pCEBV7; PCR, polymerase chain reaction; kb, kilobase(s); S,
sense; AS, antisense; mAb, monoclonal antibody; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; NBD, nucleotide
binding domain; MSD, membrane-spanning domain. ![]()
Address correspondence to: Dr. Roger G. Deeley, Division of Cancer Biology and Genetics, Queen's University Cancer Research Institute, Botterell Hall, Queen's University, Kingston, Ontario K7L 3N6, Canada. E-mail: deeleyr{at}post.queensu.ca
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Sun, L. Liu, and K. S. Pang Increased Estrogen Sulfation of Estradiol 17beta-D-Glucuronide in Metastatic Tumor Rat Livers J. Pharmacol. Exp. Ther., November 1, 2006; 319(2): 818 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hanggi, A. F. Grundschober, S. Leuthold, P. J. Meier, and M. V. St-Pierre Functional Analysis of the Extracellular Cysteine Residues in the Human Organic Anion Transporting Polypeptide, OATP2B1 Mol. Pharmacol., September 1, 2006; 70(3): 806 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Deeley, C. Westlake, and S. P. C. Cole Transmembrane Transport of Endo- and Xenobiotics by Mammalian ATP-Binding Cassette Multidrug Resistance Proteins. Physiol Rev, July 1, 2006; 86(3): 849 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dallas, D. S. Miller, and R. Bendayan Multidrug resistance-associated proteins: expression and function in the central nervous system. Pharmacol. Rev., June 1, 2006; 58(2): 140 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tochigi, N. Yamashiki, S. Ohgiya, S. Ganaha, and H. Yokota ISOFORM-SPECIFIC EXPRESSION AND INDUCTION OF UDP-GLUCURONOSYLTRANSFERASE IN IMMUNOACTIVATED PERITONEAL MACROPHAGES OF THE RAT Drug Metab. Dispos., September 1, 2005; 33(9): 1391 - 1398. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yu, K. von Bergmann, D. Lutjohann, H. H. Hobbs, and J. C. Cohen Selective sterol accumulation in ABCG5/ABCG8-deficient mice J. Lipid Res., February 1, 2004; 45(2): 301 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-W. Zhang, H.-M. Gu, D. Situ, A. Haimeur, S. P. C. Cole, and R. G. Deeley Functional Importance of Polar and Charged Amino Acid Residues in Transmembrane Helix 14 of Multidrug Resistance Protein 1 (MRP1/ABCC1): IDENTIFICATION OF AN ASPARTATE RESIDUE CRITICAL FOR CONVERSION FROM A HIGH TO LOW AFFINITY SUBSTRATE BINDING STATE J. Biol. Chem., November 14, 2003; 278(46): 46052 - 46063. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||