![]() |
|
|
Faculty of Pharmaceutical Sciences, Tokyo University of Science, Chiba, Japan (T.N., A.G., I.T.); Faculty of Pharmaceutical Sciences, Kanazawa University, Kanazawa, Japan (T.N., M.N., T.Y., A.T.) Medical Genetics Research Center, Nara Medical University, Nara, Japan (S.S.) Chugai Pharmaceutical Co. Ltd., Ibaraki, Japan (J.-I.N.)
(Received July 21, 2003; Accepted November 12, 2003)
| Abstract |
|---|
|
|
|---|
|
After oral administration, cumulative recovery of troglitazone and its metabolites was 85% in feces (Loi et al., 1999
), and M-1 excreted into bile was reabsorbed in the intestine as M-1 and troglitazone after deconjugation (Kawai et al., 2000
). Moreover, the plasma area under the curve value of M-1 was 4-fold high in patients with impaired liver function than in healthy volunteers, and plasma half-life was longer in patients with moderate or severe hepatic impairment (Ott et al., 1998
). Accordingly, the failure of hepatic excretion of M-1 might lead to hepatotoxicity, although M-1 itself is pharmacologically inactive and did not exhibit cytotoxicity in human hepatoma cells (Loi et al., 1999
; Yamamoto et al., 2001
).
Recently, it was reported that M-1 inhibited the hepatobiliary elimination of bile salts by the bile salt export pump (Bsep1) located on the canalicular membrane of hepatocytes in rats (Funk et al., 2001
). Moreover, Kostrubsky et al. (2001
) suggested that Mrp2, which is expressed on the canalicular membrane of hepatocytes, might participate in the excretion of troglitazone and its metabolites. When M-1 is accumulated in hepatocytes at high concentrations, it may disturb the hepatobiliary export of bile acids by inhibition of Bsep and Mrp2, leading to intrahepatic cholestasis. Therefore, in this study we focused on the hepatic basolateral membrane transporters, since they are important in the hepatic handling of physiological and xenobiotic compounds between blood and hepatocytes.
In the human, organic anion transporting polypeptides OATP-B (SLC02B1), OATP-C (SLC01B1), and OATP8 (SLC01B3) are expressed on the basolateral membrane of hepatocytes (Hagenbuch and Meier, 2003
). Among them, OATP-C and OATP8 show a broad recognition spectrum for amphipathic substrates and play physiologically important roles in hepatic handling of xenobiotics and endogenous compounds.
We hypothesized that the troglitazone-associated hepatotoxicity is related to the accumulation of M-1 in hepatocytes by OATP transporters. Therefore, we examined the transport activity of OATP transporters for M-1 and the potential interaction of thiazolidinediones and/or the metabolites of troglitazone and endogenous OATP substrates.
| Materials and Methods |
|---|
|
|
|---|
All other reagents were purchased from Sigma-Aldrich (St. Louis, MO) and Wako Pure Chemicals (Osaka, Japan). cDNA Cloning of OATP Transporters. Cloning of cDNAs for OATP-B and OATP-C was described previously (Tamai et al., 2000
). For cDNA cloning of OATP8, amplification of the coding sequence was performed by using human liver Marathon-Ready cDNA (BD Biosciences Clontech, Palo Alto, CA). Oligonucleotide primers (5' primer: CGTGGATCCTGTAGTTTAATAATGGACC; 3' primer: GTTGGAATTGTCAGTGAAAGACC) were designed based on the human OATP8 sequence (GenBank accession no. AJ251506
[GenBank]
). The polymerase chain reaction was performed with KOD (Plus) (Toyobo Engineering, Osaka, Japan) as follows: 2 min at 94°C, followed by 35 cycles of 15 s at 94°C,30 s at 60°C, and 2.5 min at 68°C. A major 2.2-kilobase polymerase chain reaction product was fully sequenced and subcloned into expression vector pcDNA3 (Invitrogen, San Diego, CA).
Transport Study. For transport experiments, oocytes were injected with complementary RNA (cRNA) of each OATP as described previously (Tamai et al., 2001
). Uptake was initiated by incubating the oocytes at 25°C in modified Barth's solution (MBS; 96 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 0.82 mM MgSO4, 0.33 mM Ca(NO3)2, 0.41 mM CaCl2, and 10 mM HEPES, adjusted to pH 7.4 with NaOH) containing M-1 or [3H]estrone-3-sulfate. For measurement of M-1 uptake, 10 oocytes were washed and sonicated in 100 µl of MBS at appropriate times. The sample was treated with an equal volume of methanol and the precipitated protein was removed by centrifugation (13,000g, 10 min). A 100-µl portion of the supernatant was subjected to high-pressure liquid chromatography as described previously (Watanabe et al., 2002
). For the uptake of [3H]estrone-3-sulfate, oocytes were washed and solubilized. Then, the associated radioactivity was measured by means of a liquid scintillation counter. The thiazolidinedione chemicals dissolved in dimethyl sulfoxide (10 mM stock solution) were used, and final concentration of the dimethyl sulfoxide was 0.1%.
Data Analysis. The uptake of test compound by OATP was evaluated after subtracting the uptake by uninjected oocytes from the uptake by OATP cRNA-injected oocytes. All data were expressed as means ± S.E.M., and statistical analysis was performed by Student's t test or Kruskal-Wallis test. The criterion of significance was p < 0.05.
| Results |
|---|
|
|
|---|
|
Affinity of Troglitazone, its Metabolites, Pioglitazone, and Rosiglitazone, for OATP-C or OATP8. We evaluated the inhibitory effects of thiazolidinediones and the metabolites of troglitazone on the uptake of [3H]estrone-3-sulfate by OATP-C and OATP8. Since the plasma concentration of troglitazone has been reported to be 3.6 to 6.3 µM (Loi et al., 1997
), we conducted the concentration of inhibitor at 1 and 10 µM as clinically relevant concentrations. Uptake of [3H]estrone-3-sulfate was significantly higher in oocytes injected with cRNA of both OATP-C and OATP8 than that by uninjected oocytes (Fig. 3). The uptake of [3H]estrone-3-sulfate by OATP-C reached 3.3 ± 0.3 µl/oocyte/30 min as a cell-to-medium ratio, whereas that by OATP8 was 0.79 ± 0.10 µl/oocyte/120 min, and that by noninjected oocytes was 0.17 ± 0.01 µl/oocyte/120 min. Figure 4 shows the inhibitory effect of troglitazone and its metabolites, pioglitazone and rosiglitazone, on the uptake of [3H]estrone-3-sulfate by OATP-C or OATP8. M-1 showed the strongest inhibitory effect on the uptake of [3H]estrone-3-sulfate by both OATP-C and OATP8, and its effect was concentration-dependent at 1 and 10 µM. M-2 inhibited only the uptake by OATP-C, but not that by OATP8. Pioglitazone and rosiglitazone significantly inhibited the uptake of [3H]estrone-3-sulfate by OATP-C, but their inhibitory effects were weaker than that of troglitazone. The uptake by OATP8 was significantly inhibited by pioglitazone but not by rosiglitazone at 10 µM. These results demonstrated that M-1 and related compounds have higher affinity for OATP-C than for OATP-8.
|
|
| Discussion |
|---|
|
|
|---|
In the present study, we examined whether OATP transporters are involved in the accumulation of M-1 in human liver and whether thiazolidinediones and the metabolites of troglitazone inhibit OATP transporters expressed at the basolateral membrane of human hepatocytes. The uptake study, which used oocytes expressing OATP-B, OATP-C, or OATP8, demonstrated that OATP-C and possibly OATP8 could transport M-1, although we cannot conclude that OATP-B does not transport M-1 because of the less expressed activity of OATP-B in the oocytes in the present study (Fig. 2). As expected from previous studies that sulfate conjugates have higher affinity to OATP-C compared with glucuronide conjugates (Tamai et al., 2001
), the uptake of [3H]estrone-3-sulfate by OATP-C was strongly inhibited by 1 and 10 µM M-1, to 14.5 and 5.2% of the control, respectively (Fig. 4a). Moreover, the inhibitory effect was stronger than that of sulfobromophthalein and cyclosporine, which inhibited the OATP-C-mediated [3H]estrone-3-sulfate uptake to 8.0 and 6.1% at 50 and 10 µM, respectively (Nozawa et al., 2003
). Although the Km value of M-1 transport by OATP-C could not be determined in this study because of the limit of quantification by high-pressure liquid chromatography, the strong inhibition of M-1 suggested that M-1 has high affinity to OATP-C among the substrates of OATP-C (Hagenbuch and Meier, 2003
). Therefore, M-1 would be taken up into human hepatocytes via OATP-C with high affinity and would be accumulated, leading to disturbance of the function of Bsep and Mrp2 (Funk et al., 2001
; Kostrubsky et al., 2001
).
Many test compounds inhibited [3H]estrone-3-sulfate uptake by OATP-C and OATP8 at 10 µM or at a lower concentration (Fig. 4). Since OATP-C and OATP8 have a broad spectrum of substrates, the inhibitory effects may result in some alteration of physiological homeostasis (Hagenbuch and Meier, 2003
). In particular, it was reported that the plasma concentration of M-1 reached 2 to 10 µM after i.v. administration in rats and dogs at a dose of 5 mg/kg (Kawai et al., 1997
). Accordingly, the M-1 concentration in plasma may be high enough to inhibit OATP transporters nearly completely.
Recently, the polymorphisms of transporters and enzymes have been reported to cause interindividual alterations of their expression levels and/or functions. Since troglitazone-associated hepatitis is thought to be rare and idiosyncratic, the hepatitis may be related to the genetic polymorphisms of OATP transporters. Some types of genetic polymorphism with functional alteration of OATP-C have been reported, and such alterations of apparent OATP-C activity may lead to accumulation of M-1 in plasma or liver, resulting in troglitazone-associated toxicity (Tirona et al., 2001
; Michalski et al., 2002
; Nozawa et al., 2002
).
In conclusion, we demonstrated that OATP-C and possibly OATP8 transport the major metabolite of troglitazone, M-1, which could thereby be accumulated in human liver. Furthermore, thiazolidinediones and the metabolites of troglitazone inhibit OATP-C and/or OATP8, and the inhibitory effects may disturb the homeostasis of endogenous and/or xenobiotic compounds. These effects might account, at least in part, for the hepatic toxicity of troglitazone.
| Footnotes |
|---|
1 Abbreviations used are: Bsep, bile salt export pump; OATP, organic anion transporting polypeptide; cRNA, complementary RNA; MBS, modified Barth's solution. ![]()
Address correspondence to: Dr. Ikumi Tamai, Department of Molecular Biopharmaceutics, Faculty of Pharmaceutical Sciences, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510, Japan. E-mail: tamai{at}rs.noda.tus.ac.jp
| References |
|---|
|
|
|---|
agonist, in patients with hepatic insufficiency. Eur J Clin Pharmacol 54: 567-571.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Grime, P. J. H. Webborn, and R. J. Riley Functional Consequences of Active Hepatic Uptake on Cytochrome P450 Inhibition in Rat and Human Hepatocytes Drug Metab. Dispos., August 1, 2008; 36(8): 1670 - 1678. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Bachmakov, H. Glaeser, M. F. Fromm, and J. Konig Interaction of Oral Antidiabetic Drugs With Hepatic Uptake Transporters: Focus on Organic Anion Transporting Polypeptides and Organic Cation Transporter 1 Diabetes, June 1, 2008; 57(6): 1463 - 1469. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Enokizono, H. Kusuhara, and Y. Sugiyama Involvement of Breast Cancer Resistance Protein (BCRP/ABCG2) in the Biliary Excretion and Intestinal Efflux of Troglitazone Sulfate, the Major Metabolite of Troglitazone with a Cholestatic Effect Drug Metab. Dispos., February 1, 2007; 35(2): 209 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cheng, J. Maher, M. Z. Dieter, and C. D. Klaassen REGULATION OF MOUSE ORGANIC ANION-TRANSPORTING POLYPEPTIDES (OATPS) IN LIVER BY PROTOTYPICAL MICROSOMAL ENZYME INDUCERS THAT ACTIVATE DISTINCT TRANSCRIPTION FACTOR PATHWAYS Drug Metab. Dispos., September 1, 2005; 33(9): 1276 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chang, K. S. Pang, P. W. Swaan, and S. Ekins Comparative Pharmacophore Modeling of Organic Anion Transporting Polypeptides: A Meta-Analysis of Rat Oatp1a1 and Human OATP1B1 J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 533 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Kemp, M. J. Zamek-Gliszczynski, and K. L. R. Brouwer Xenobiotics Inhibit Hepatic Uptake and Biliary Excretion of Taurocholate in Rat Hepatocytes Toxicol. Sci., February 1, 2005; 83(2): 207 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nozawa, M. Suzuki, K. Takahashi, H. Yabuuchi, T. Maeda, A. Tsuji, and I. Tamai Involvement of Estrone-3-Sulfate Transporters in Proliferation of Hormone-Dependent Breast Cancer Cells J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 1032 - 1037. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. He, R. E. Talaat, W. F. Pool, M. D. Reily, J. E. Reed, A. J. Bridges, and T. F. Woolf METABOLIC ACTIVATION OF TROGLITAZONE: IDENTIFICATION OF A REACTIVE METABOLITE AND MECHANISMS INVOLVED Drug Metab. Dispos., June 1, 2004; 32(6): 639 - 646. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||