DMD Large equally mixed donor pool

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


0090-9556/04/3204-424-430$20.00
DMD 32:424-430, 2004

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bahn, A.
Right arrow Articles by Hagos, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bahn, A.
Right arrow Articles by Hagos, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*FLUORESCEIN
*FUROSEMIDE
*P-AMINOHIPPURIC ACID

EXPRESSION STUDIES AND FUNCTIONAL CHARACTERIZATION OF RENAL HUMAN ORGANIC ANION TRANSPORTER 1 ISOFORMS

Andrew Bahn, Christian Ebbinghaus, Diana Ebbinghaus, Evgeni G. Ponimaskin, Laszlo Fuzesï, Gerhard Burckhardt, and Yohannes Hagos

Zentrum für Physiologie und Pathophysiologie, Abt. Vegetative Physiologie und Pathophysiologie, (A.B., C.E., D.E., G.B., Y.H.); Zentrum für Physiologie und Pathophysiologie, Abt. Neuro- und Sinnesphysiologie, (E.G.P.); and Zentrum Pathologie, Universität Göttingen, Göttingen, Germany (L.F.)

(Received August 5, 2003; Accepted January 9, 2004)


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The human organic anion transporter 1 (hOAT1) facilitates the basolateral entry of organic anions such as endogenous metabolites, xenobiotics, and drugs into the proximal tubule cells. In the present study we investigated the general occurrence of hOAT1 isoforms in the kidneys and performed functional characterizations. Kidney specimens of 10 patients were analyzed by reverse transcription-polymerase chain reaction. We detected hOAT1-2 as the main transcript in almost all patients, and weak transcripts of hOAT1-1, hOAT1-3, and hOAT1-4 in many of them. An evaluation of the renal distribution showed all four mRNAs mostly restricted to the cortex. Western blot analysis of membrane fractions from two kidney specimens yielded two bands corresponding to the observed mRNA expression, suggesting hOAT1-3 and hOAT1-4 to be expressed on the protein level in vivo. This observation is further supported by immunofluorescence analyses of all four cloned hOAT1 isoforms transiently transfected in COS 7 cells. Functional characterizations did not show any transport activity of hOAT1-3 and hOAT1-4 for the tested substrates. Cotransfection studies of each of them with hOAT1-1 did not alter fluorescein uptake indicating no regulatory impact of these isoforms. Further functional comparisons of hOAT1-1 and hOAT1-2 in fluorescein uptake studies exhibited almost identical affinities for fluorescein with Michaelis constants of 11.6 ± 3.7 µM (hOAT1-1) and 11.9 ± 6.4 µM (hOAT1-2), and similar sensitivities to inhibition by p-aminohippurate [IC50: 16 µM (hOAT1-1), 10 µM (hOAT1-2)], urate [IC50: 440 µM (hOAT1-1), 385 µM (hOAT1-2)], and furosemide (IC50: 14 µM (hOAT1-1), 20 µM (hOAT1-2)], implying functional equivalence.


The efficient elimination of endogenous metabolites, drugs, and xenobiotics in the kidneys requires the concerted action of polyspecific transporters like organic anion transporters (OATs1) and organic cation transporters (OCTs) (for review, see Burckhardt and Pritchard, 2000Go). The family of organic anion transporters (OAT, SLC22A) was discovered in 1997 with the cloning of the renal rat and flounder OAT1 (rOAT1, Sekine et al., 1997Go; Sweet et al., 1997Go; fOAT, Wolff et al., 1997Go). Meanwhile, OAT1 is the best studied transport protein within this OAT family, with nine actually identified and in part functionally characterized orthologs: human (Reid et al., 1998Go; Hosoyamada et al., 1999Go), mouse (Lopez-Nieto et al., 1997Go), rat (Sekine et al., 1997Go; Sweet et al., 1997Go), rabbit (Bahn et al., 2002Go), pig (Hagos et al., 2002Go), OK-cell [AJ308236; AJ308236 [GenBank] : Didelphis virginiana partial mRNA for putative organic anion transporter (okOAT1 gene), Y. Hagos, M. Sendler, A. Babu, and G. Burckhardt, 2001, unpublished], cattle [AJ549816; AJ549816 [GenBank] : Bos taurus mRNA for organic anion transporter 1 (oat1 gene), J. Geyer and E. Petzinger, unpublished], winter flounder (Wolff et al., 1997Go), and Caenorhabditis elegans (George et al., 1999Go). OAT1 plays a major role in the renal secretion of preferentially hydrophilic organic anions such as endogenous metabolites, xenobiotics, and drugs (Dresser et al., 2001Go; Burckhardt et al., 2002Go; Burckhardt and Burckhardt, 2003Go). Located on the basolateral side of the proximal tubule cells, it mediates the uptake of these compounds into the cells against a negative membrane potential and in exchange for the Krebs cycle intermediate {alpha}-ketoglutarate. Consequently, it is held responsible for the nephrotoxicity of some substances like the endogenous uremic toxins (Deguchi et al., 2004Go), antiviral drugs (Ho et al., 2000Go), and cephaloridines (Takeda et al., 1999Go), as well as the mycotoxin ochratoxin A (Tsuda et al., 1999Go). Besides kidneys, OAT1 was also detected in other organs such as liver, skeletal muscle, brain, and eye (Cihlar et al., 1999Go; Pritchard et al., 1999Go; Bahn et al., 2003Go), where it may be involved in the secretion of neurotransmitter metabolites.

Recent findings of alternative splice-variants in this SLC22A family of transporters [e.g., the rat organic cation transporter 1 (rOCT1; Zhang et al., 1997Go), the human OCT2 (Urakami et al., 2002Go), and the human OAT1 (Bahn et al., 2000Go)], as well as "single nucleotide polymorphisms" (Leabman et al., 2002Go)] suggest a potential impact on the pharmacokinetics and substrate selectivity in vivo. Knowledge about the uptake and excretion capacity of a patient for a specific substance becomes increasingly important in terms of future concepts for a specific therapy or an individual dose for drug treatment.

Our previous studies concerning the in vivo expression of hOAT1 in kidney specimens of a patient revealed, besides the known two isoforms hOAT1-1 and hOAT1-2, two new isoforms, hOAT1-3 and hOAT1-4, which possess an additional in-frame deletion of 132 bp (Bahn et al., 2000Go). In the present report, we determined the expression of human OAT1 isoforms in different patients and investigated their distribution in the kidneys. Additionally, all four hOAT1 isoforms were cloned and functionally characterized. Our results confirm that all four hOAT1 isoforms are constitutively expressed in the kidneys, with hOAT1-2 as the main transcript in kidney cortex. No function was detected for hOAT1-3 and hOAT1-4. A functional comparison of hOAT1-1 and hOAT1-2 showed that they resembled each other in their sensitivities for p-aminohippurate (PAH), urate, and furosemide, indicating that both isoforms contribute to the excretion of these substances.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Materials. Materials used included fetal bovine serum, trypsin, PBS (from Invitrogen, Groningen, The Netherlands), buffer ingredients, unlabeled substrates, such as PAH, urate, and furosemide (Sigma-Aldrich, Deisenhofen, Germany), and fluorescein (FL; from Molecular Probes, Leiden, The Netherlands).

Total RNA Extraction and RT-PCR. Twenty to 50 mg of human kidney tissue of 10 different donors was extracted with the SV-total-RNA-isolation system (Promega, Mannheim, Germany) according to the manufacturer's protocol. For the reverse transcription, 0.5 to 2 µg of total RNA, 4 U of Omniscript reverse transcriptase (QIAGEN, Hilden, Germany), and an oligod(T)-anchor primer (5' GACCACGCGTATCGATGTCGAC (T)18(AGC) 3'), including the standard rapid amplification of cDNA ends (RACE) sequence as a terminal linker, were used in a reaction for 1 h at 37°C. The subsequent standard PCR (94°C, 2 min; 94°C, 30 s; 55°C, 30 s; 72°C, 1 min, for 35 cycles) was performed with 2 to 4 µl of the RT-reaction and with the sense primer (Ex-U: 5' TTCCACTAGCTTTGCCTACTATG 3') and the antisense primers (Ex-R: 5' CTCTTGTGCTGAGGCCTG 3') in a PTC200 thermal cycler (MJ Research, Biozym Diagnostik, Hess. Oldendorf, Germany). PCR products were visualized after separation on an agarose gel with ethidium bromide using an UV-transilluminator (UVP, Upland, CA). Specificity of hOAT1 splice products was checked by Southern blot.

"Overlap"-PCR. Starting with the hOAT1-2 isoform, we generated two fragments of 1612 bp and 149 bp in a PCR (94°C, 1 min; 94°C, 15 s; 55°C, 15 s; 72°C, 1 min, for 35 cycles) using the primer sets (hOAT1-U: 5' GGGGATCCATGGCCTTTAATGACC 3'; 39-bp hOAT1-R: 5' CTGGGATATATCCCTGCTTCTTTCTGAGTGGGGGCCCACCTGCTCTCCAGGTCCTGCAC 3') and (39-bp hOAT1-U: 5' GTGGCCCCCCACTCAGAAAGAAGCAGGGATATATCCCAGGAAAGGGAAACAGACGCGAC 3' and hOAT1-R: 5' GGTCTAGACCTCAAAATCCATTC 3'), which contained the 39-bp missing fragment as a terminal linker, and 1.2 units of the proofreading polymerase powerscript (PAN Biotech, Aidenbach, Germany). After visualization of the PCR products in an agarose gel by ethidium bromide, they were cut out of the gel and extracted with the Nucleotrap-kit (Macherey-Nagel, Düren, Germany). In a final PCR (94°C, 1 min; 94°C, 15 s; 55°C, 15 s; 72°C, 1 min, for 35 cycles) with the primers (hOAT1-U: 5' GGGGATCCATGGCCTTTAATGACC 3'; hOAT1-R: 5' GGTCTAGACCTCAAAATCCATTC 3'), the full-length open reading frame of 1692 bp was amplified. This resulted in the generation of isoform hOAT1-1. These two isoforms were taken as templates to synthesize hOAT1-3 and hOAT1-4, applying the same PCR strategy with the primers (hOAT1-U: 5' GGGGATCCATGGCCTTTAATGACC 3'; 132-bp hOAT1-R: 5' GCAGGAGGACAGTGACAGCGCGGATCATTGTGGGATACAG 3') and (132bp-hOAT1-U: 5' CTGTATCCCACAATGATCCGCGCTGTCACTGTCCTCCTGC 3' and hOAT1-R 5' GGTCTAGACCTCAAAATCCATTC 3'). All four open reading frames hOAT1-1 to hOAT1-4 were cloned with the TOPO-pcDNA3.1-cloning kit (Invitrogen) according to the manufacturer's protocol. Recombinant clones were screened by PCR and sequence-verified.

Sequencing. Positive clones of the final constructs hOAT1-1, hOAT1-2, hOAT1-3, and hOAT1-4 were sequenced with primers derived from the hOAT1-cDNA with an automated sequencer (ABI, Weiterstadt, Germany). Sequence analysis was done using online services (e.g., MAP; Huang 1994Go).

Cell Culture and Uptake Experiments. The monkey kidney cell line COS 7 was cultivated in plastic flasks or Petri dishes (Sarstedt, Nümbrecht, Germany) in Dulbecco's modified Eagle's medium (Invitrogen) with 580 mg/l glutamine, 110 mg/l Na-pyruvate, and 10% heat-inactivated fetal calf serum in 5% CO2 at 37°C. Five micrograms of hOAT1-pcDNA3.1 constructs were transiently transfected into COS 7 cells by electroporation (GenePulser II; Bio-Rad, München, Germany) at 250 V and 300 µF. Twenty-four hours after transfection, the cells were plated in six-well plastic dishes (Sarstedt) at a density of 2 x 105 cells/well. Transport assays were performed 48 h posttransfection in buffer (110 mM NaCl, 3 mM KCl, 1 mM CaCl2, 0.5 mM MgSO4, 1 mM KH2PO4, 10 mM HEPES, and 5 mM glucose at a pH of 7.5). The cells were washed twice with buffer and incubated at room temperature for 5 min in buffer containing 1 µM FL. The incubation was stopped and the extracellular FL was removed by washing the monolayer two to three times with 500 to 1000 µl of ice-cold PBS. Cells were dissolved in 1 ml 0.5 N NaOH. To assess FL accumulation, fluorescence was measured in a fluorescence spectrophotometer (Hitachi, Tokyo, Japan) at 492/512 nm (excitation/emission). The protein content of each well was determined according to the Bradford procedure (Bradford, 1976Go). For the determinations of the urate, p-aminohippurate, or furosemide concentrations that blocked 50% of FL uptake (IC50), the following equation (eq. 1) was used and fitted by nonlinear regression with SigmaPlot 2001 (SPSS Inc., Chicago, IL).

(1)
where {nu} is the rate of FL uptake in the presence of the inhibitor (urate, p-aminohippurate, or furosemide), {nu}0 is the rate of FL uptake in the absence of the inhibitor (in this case set to 100%), I is the inhibitor concentration, and h is the Hill coefficient, representing the cooperativity between the tested substances and the transporter.

The Michaelis-Menten kinetics (Km values) for hOAT1-1 and hOAT1-2 using fluorescein were determined according to eq. 2:

(2)

Immunofluorescence. All four hOAT1 isoforms were transiently transfected into COS 7 cells as described above and seeded on coverslips in a 24-well dish at a density of 2 x 105 cells/well. After 48 h, the cells were washed two times with PBS and fixed for 8 min in 3.7% formaldehyde/PBS solution. For the immunoassay, the cells were washed two times with PBS and permeabilized by an incubation for 5 min in permeabilization buffer (50 mM sodium phosphate buffer, pH 7.4, 0.5 M NaCl, 0.3% TX-100). Subsequently, the cells were blocked with blocking solution (33% goat serum, 0.1% TX-100 in PBS) for 30 min and incubated with a polyclonal rabbit anti-OAT1 antibody, OAT11-A (Alpha Diagnostic, San Antonio, TX) in a dilution of 1:20 for 1 h. The first antibody was removed by two washing steps with PBS/0.1% bovine serum albumin. The cells were probed with the second antibody [Alexa fluor 488 goat anti-rabbit IgG (H+L) conjugate (Molecular Probes)] in a dilution of 1:200 PBS/0.1% bovine serum albumin for 1 h. Afterward, the cells were mounted with an 80% glycerol/20 mM NaHCO3 solution, the coverslip was sealed, and the probes were analyzed with an LSM510-META (Zeiss, Jena, Germany).

Preparation of the Membrane Fractions and Western Blot Analysis. Kidney tissue (50 mg, from patients 4 and 7) was ground up in liquid nitrogen with a mortar and pestle and suspended in 1 ml of membrane buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 10 mg/ml phenylmethylsulfonyl fluoride, 4 µg/ml aprotinin, 4 µg/ml leupeptin). After a further homogenization step with an Ultra-Turrax homogenizer, the probes were centrifuged for 10 min at 12000 rpm and 4°C. The pellet was discarded and the supernatant was centrifuged for 30 min at 50,000 rpm and 4°C (Beckman TLX ultracentrifuge, TLA 100.3 rotor; Beckman-Coulter, Fullerton, CA). The resulting pellet (membrane fraction) was resuspended in loading buffer (5 mM Tris-HCl, pH 6.8, 10% glycerol, 1% ß-mercaptoethanol, 1% SDS, 0.004% bromphenol blue) and heated (85°C, 10 min), and the protein content was determined according to the method of Bradford (1976Go). Equal amounts of protein were loaded onto a 10% polyacrylamide gel, size-fractionated for 45 min at 50 mA, and blotted to a polyvinylidene difluoride membrane at 40 mA overnight. The membrane was blocked with 5% dry milk in PBS/0.05% Tween 20 for 1 h at room temperature, and the immunoassay was performed with a polyclonal rabbit anti-OAT1 antibody, OAT11-A (Alpha Diagnostic International, San Antonio, TX) in a dilution of 1:40 overnight at 4°C on an orbital shaker. Afterward, the membrane was washed three times with PBS/0.1% Tween 20 and incubated with the second antibody, an anti-rabbit IgG coupled to horseradish peroxidase, in a dilution of 1:10,000 for 1 h at room temperature. After three more washing steps with PBS/0.1% Tween 20, immunoreactive bands were visualized using the Western blotting detection system (Amersham Biosciences Inc., Freiburg, Germany).

Kinetic and Statistical Analysis. Unless indicated otherwise, data are the mean (±S.E.M.) of three independent experiments with three repeats each. Statistical analysis was performed with Microsoft Excel (Microsoft, Unterschleißheim, Germany) and SigmaPlot 2001 (SPSS Inc.).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
hOAT1 Isoform Expression in Human Kidneys. Total RNA of kidney specimens of seven different patients was extracted and the expression of the hOAT1 isoforms was examined by RT-PCR analysis. Applying the primer set Ex-U/Ex-R, we amplified all four isoforms with product sizes of 637 bp (hOAT1-1), 598 bp (hOAT1-2), 505 bp (hOAT1-4), and 466 bp (hOAT1-3) in all investigated patients (Fig. 1A). Most of them, including the commercially available control-mRNA (Fig. 1A, lane C; Ambion, Austin, TX), showed hOAT1-2 as the mainly represented isoform. Interestingly, one mRNA (patient 4) exhibited a comparable expression of the isoforms hOAT1-2, hOAT1-3, and hOAT1-4, indicating individual variation and thus a possible change in the impact of isoform hOAT1-3 and isoform hOAT1-4.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 1. Detection and distribution of hOAT1 isoforms in human kidneys using RT-PCR.

Kidney specimens of seven patients (for the expression of hOAT1 isoforms) and of three patients (for the distribution of the hOAT1 isoforms) were extracted, and the expression of hOAT1 isoforms was investigated by RT-PCR techniques. A, 1–7 represent kidney specimens of seven different patients; C is a commercially available control mRNA of human kidneys; M represents a 100-bp DNA ladder; white arrows indicate the visible isoform: 1 for hOAT1-1; 2 for hOAT1-2; 3 for hOAT1-3, and 4 for hOAT1-4. B, C1–C3 represent three different kidney cortex specimens; M1–M3 are three different specimens from kidney medulla; controls are (from left to right) RT neg., PCR-H2O, and hOAT1-1 as a positive control; M is a 100-bp DNA marker. C, a Western blot analysis of membrane fractions from kidney specimens of two patients (cf. A, patients 4 and 7) is provided in the upper picture, and as a control for the amount of analyzed protein, a ß-actin labeling was performed, shown in the lower picture.

 

For the analysis of the distribution of hOAT1 isoforms, kidney cortex (C1–C3) and medulla (M1–M3) were prepared from three different patients and analyzed by RT-PCR. An expression of all four isoforms was found in kidney cortex, whereas hOAT1-2 was weak or absent in the medulla (Fig. 1B). hOAT1-3 and hOAT1-4 appeared to be present in equivalent amounts in the medulla and the cortex, documenting that the expression of some isoforms of hOAT1 is not restricted to the proximal tubule as previously shown for OAT1 (Hosoyamada et al., 1999Go). Additional Western blot analyses of membrane fractions of kidney specimens from patients 4 and 7 revealed two specific bands with a mass of approximately 80 kDa and 70 kDa for both patients (Fig. 1C), comparable to the observed mRNA expression of hOAT1-2 and the new isoforms hOAT1-3 and hOAT1-4 (cf. Fig. 1B). Furthermore, we examined the distribution of hOAT1 in other tissues using "multiple-tissue plates" (RZPD, Berlin, Germany). Initial PCR screenings revealed the expression of all hOAT1 isoforms also in different parts of the brain (data not shown).

Cloning and Functional Comparison of hOAT1 Isoforms. Rapid amplification of cDNA ends (RACE) techniques did not reveal any additional information of a further modification or alteration of hOAT1-3 and hOAT1-4 open reading frames (data not shown). For this reason, we cloned all four hOAT1 isoforms for functional investigations as illustrated in Fig. 2 (for more detailed information, see Bahn et al., 2000Go) using an overlap-PCR strategy. All hOAT1 isoforms used for functional characterizations were sequence-verified and in part repaired by applying site-directed mutagenesis (Stratagene, Amsterdam, The Netherlands).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 2. Illustration of the putative protein structure of the hOAT1 isoforms.

Derived from the protein sequence are the predicted putative secondary structures of hOAT1-1–hOAT1-4. Indicated with filled circles are the deleted parts of the protein for each hOAT1 isoform.

 

Initial functional studies were performed on COS 7 cells transiently transfected with 5 µg of the respective hOAT1 isoform. Fluorescein (1 µM) was taken as a tracer in an uptake assay over 5 min, which is a good compromise between a sufficient signal-to-noise ratio and the linear (initial) phase of fluorescein uptake by hOAT1 (data not shown). hOAT1-1 and hOAT1-2 exhibited nearly the same fluorescein uptake into COS 7 cells, whereas hOAT1-3 and hOAT1-4 did not show any uptake of fluorescein comparable to nontransfected cells (Fig. 3). Since hOAT1-3 or hOAT1-4 may have regulatory effects, we performed cotransfections of hOAT1-1 with each of the other isoforms, taking 2.5 µg of DNA of each isoform for the transfection. A cotransfection of hOAT1-1 with hOAT1-2 revealed an almost identical uptake of fluorescein compared with the value of hOAT1-1 or hOAT1-2 at 5 µg (cf. Fig. 3). hOAT1-3 or hOAT1-4 transfected together with hOAT1-1 led to a reduction of fluorescein transport by 50%, but did not abolish fluorescein uptake, indicating that they do not possess a dominant negative effect.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3. Functional characterization of all four hOAT1 isoforms.

All four isoforms of hOAT1 were transiently transfected into COS 7 cells, investigating 5 µg of the plasmid. Fluorescein (1 µM) was used for uptake experiments at room temperature for 5 min. Cotransfections of hOAT1-1 with all other hOAT1 isoforms with 2.5 µg of DNA each are shown.

 

Immunofluorescence Analysis of hOAT1 Isoform Expression. The fact that hOAT1-3 and hOAT1-4 did not show any function leads to the questions, whether they are expressed as a protein and whether they occur in the membrane. To address these questions, we transiently transfected all four hOAT1 isoforms into COS 7 cells and analyzed hOAT1 protein expression with an OAT1-specific antibody, followed by an immunofluorescence labeling and laser scan microscopy. Since the epitope is located intracellularly, cells had to be permeabilized for labeling, preventing immunodetection of membrane-bound hOAT1. Nevertheless, Fig. 4 indicates that a lack of protein expression is not the reason for the functional defects of hOAT1-3 and hOAT1-4.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 4. Immunofluorescence analysis of the membrane localization of all four isoforms transiently transfected into COS 7 cells using a confocal laser scan imaging system.

One representative picture is provided for each hOAT1 isoform. The control was examined without the first antibody to exclude unspecific binding.

 

Functional Characterization of hOAT1-1 and hOAT1-2. To explore possible differences that may explain the existence of both isoforms, we performed functional comparisons between hOAT1-1 and hOAT1-2. First, we examined the concentration dependence of fluorescein uptake by hOAT1-1 and hOAT1-2. Figure 5 shows the kinetics of hOAT1-1- and hOAT1-2-mediated fluorescein transport in a representative experiment. In three separate experiments on COS 7 cells expressing hOAT1-1, Jmax was 76.1 ± 12.2 pmol · mg-1 protein · 5 min-1 with a Km of 11.6 ± 3.7 µM, and in cells expressing hOAT1-2, Jmax was 53 ± 10.8 pmol · mg-1 protein · 5 min-1 with a Km of 11.9 ± 6.4 µM. The similar affinities of both transporters for fluorescein made it reasonable to test the interaction of other known substrates with the two hOAT1 isoforms.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. Kinetics of fluorescein transport by hOAT1-1 and hOAT1-2.

Concentration dependence of hOAT1-1(circles) and hOAT1-2(triangles) mediated FL uptake into transiently transfected COS 7 cells for 5 min at room temperature. Boxes represent the uptake of FL by nontransfected cells as a control.

 

Increasing concentrations of unlabeled PAH inhibited fluorescein transport with an IC50 of 16 µM and 10 µM for hOAT1-1 and hOAT1-2 (Fig. 6), respectively. Using increasing concentrations of urate on fluorescein uptake revealed IC50 values of 440 µM for hOAT1-1 and 385 µM for hOAT1-2 (Fig. 7). The diuretic drug furosemide was also tested on the interaction with both hOAT1 isoforms. In this case we detected an IC50 of 14 µM for hOAT1-1 and 20 µM for hOAT1-2, documenting an equivalent affinity for this drug (Fig. 8).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6. IC50 determination for PAH versus fluorescein for hOAT1-1 and hOAT1-2.

Concentration dependence of hOAT1-1(circles) and hOAT1-2(triangles) mediated uptake of FL into transiently transfected COS 7 cells at variable concentrations of PAH for 5 min at room temperature. Boxes represent the uptake of FL by nontransfected cells as a control.

 


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 7. IC50 determination for urate versus fluorescein for hOAT1-1 and hOAT1-2.

Concentration dependence of hOAT1-1(circles) and hOAT1-2(triangles) mediated uptake of FL into transiently transfected COS 7 cells at variable concentrations of urate for 5 min at room temperature. Boxes represent the uptake of FL by nontransfected cells as a control.

 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 8. IC50 determination for furosemide versus fluorescein for hOAT1-1 and hOAT1-2.

Concentration dependence of hOAT1-1(circles) and hOAT1-2(triangles) mediated uptake of FL into transiently transfected COS 7 cells at variable concentrations of furosemide for 5 min at room temperature. Boxes represent the uptake of FL by nontransfected cells as a control.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Alternative splicing of transport proteins has been shown to result in several effects, such as tissue-specific distribution, as described for the human NBC-1A and NBC-1B (Soleimani and Burnham, 2001Go); different transport protein specificity, noted for the Na+-K+-Cl- cotransporter (Plata et al., 2001Go); different membrane localization and mode of action, recently observed for the sodium/bile acid transporter ASBT (Lazaridis et al., 2000Go); and negative regulating effects, documented for splice-variants of the rat NaPi-2 (Tatsumi et al., 1998Go). Recently, we cloned the hOAT1 gene and described the detection of two new splice-variants of hOAT1, called hOAT1-3 and hOAT1-4 (Bahn et al., 2000Go). The aim of this study was to document the expression of these hOAT1 isoforms in human kidneys and to determine their function in comparison with hOAT1-1 and hOAT1-2. RT-PCR analysis of seven different kidney specimens and one control RNA revealed both isoforms without or with the 39-bp deletion (hOAT1-1 and hOAT1-2), as well as the recently described isoforms with the 132-bp deletion (hOAT1-3 and hOAT1-4) in most of the examined probes. These findings are further supported by similar results of OAT1 isoform expression in different regions of the human brain investigated by PCR-screening of multiple-tissue plates and in the rabbit kidney (data not shown), indicating a tissue- and species-independent role of OAT1 isoforms. In almost all kidney specimens (including rabbit kidney), isoform OAT1-2 is by far the highest expressed variant of OAT1. This may imply that the explored functional characteristics of basolateral organic anion transport, that are attributed to OAT1 activity in vivo (Shimomura et al., 1981Go; Groves et al., 1998Go), are based mainly on the expression of isoform OAT1-2 (for a review of OAT1 functional characteristics, see Burckhardt and Burckhardt, 2003Go). Interestingly, we found that in one investigated case (patient 4), an equal expression of hOAT1-2, hOAT1-3, and hOAT1-4 was visible, reflecting an individual alteration of hOAT1 isoform expression in vivo, possibly resulting in a change of the drug excretion capacity.

To see whether hOAT1-3 and hOAT1-4 are expressed in the same region as hOAT1-1 or hOAT1-2, we determined the renal distribution of hOAT1 isoforms. Three different specimens of kidney cortex and medulla from three different donors were analyzed. RT-PCR results exhibited a clear and high mRNA expression of hOAT1-2 in kidney cortex, whereas it was weak or not detected in the medulla. This is in accordance with the observations of Hosoyamada et al. (1999Go), who showed that OAT1 protein expression in the human kidney is restricted to the proximal tubule of kidney cortex. In the rat kidney, OAT1 mRNA expression determined by in situ hybridization was confined to the S2 segment of the proximal tubule (Sekine et al., 1997Go; Tojo et al., 1999Go). However, a recent reevaluation of OAT1 protein distribution in the human kidneys by Motohashi et al. (2002Go) revealed a wider expression of OAT1 along the proximal tubule. hOAT1-3 and hOAT1-4 were amplified in kidney cortex and weakly in the medulla, consistent with the proposed localization of human OAT1 by Motohashi et al. (2002Go). An additionally performed Western blot of membrane fractions from kidney specimens of patient 4 and patient 7 revealed a main protein product at 80 kDa (as a control, we tested a flag-coupled, heterologously expressed hOAT1, which gave a signal of the same size; data not shown) for patient 7 and a weaker protein product at 70 kDa, consistent with the results of the RT-PCR for the hOAT1 isoforms for this patient. A reduced expression of the 80-kDa band was detected for patient 4, corresponding exactly to the amplified mRNA amount. These data provide a first clue toward an in vivo expression of the newly identified splice-variants hOAT1-3 and hOAT1-4.

A functional characterization of all four hOAT1 isoforms cloned via a PCR-based strategy showed a DNA concentration-dependent uptake of fluorescein for hOAT1-1 and hOAT1-2. hOAT1-3 and hOAT1-4 did not interact with fluorescein or PAH (data not shown), indicating that hOAT1-3 and hOAT1-4 might be nonfunctional, like, for example, the splice-variants of the rat NaPi-2 (Tatsumi et al., 1998Go), the pig OAT1 isoform (Hagos et al., 2002Go), or the human OCT1 isoforms (Hayer et al., 1999Go). To explore a possible regulatory effect of hOAT1-3 and hOAT1-4 that was delineated for the rat NaPi-2 isoforms, we cotransfected isoform hOAT1-1 with equal amounts of each of the other isoforms (2.5 µg of DNA each). hOAT1-1 transfected together with hOAT1-2 revealed a fluorescein uptake comparable with the signal resulting from 5 µg of hOAT1-1. Isoforms hOAT1-3 and hOAT1-4 transfected in combination with hOAT1-1 did not abolish fluorescein uptake, indicating that hOAT1-3 and hOAT1-4 do not have a dominant negative effect on the functional isoforms, as was demonstrated for the human OCT1 isoforms (Hayer et al., 1999Go). Therefore, we had to prove whether hOAT1-3 and hOAT1-4 are expressed on the protein level and, additionally, whether these two new splice-variants are correctly processed to the membrane. All four isoforms were transiently transfected into COS 7 cells and analyzed by immunofluorescence using a commercially available OAT1 antibody and confocal laser scan microscopy. The results provide evidence that all four cloned hOAT1 isoforms are expressed as proteins in vitro. Moreover, three-dimensional reconstructions of the laser scan pictures for each splice-variant illustrated that there are no differences in protein delivery between the functional (hOAT1-1 and hOAT1-2) and nonfunctional (hOAT1-3 and hOAT1-4) isoforms of hOAT1 (data not shown). Taken together, these data, in combination with the Western blot analysis of kidney specimens, imply that the observed impairment of transport function for hOAT1-3 and hOAT1-4 is not due to a loss of expressed protein.

Our RT-PCR analysis revealed that both hOAT1-1 and hOAT1-2 are generally coexpressed in the renal cortex. Consequently, it is of interest whether they show any functional differences that may explain their coexistence. To address this question, we measured fluorescein uptake in COS 7 cells transiently transfected with hOAT1-1 or hOAT1-2 and investigated the affinity for fluorescein. Both splice-variants showed the same affinity for fluorescein with a Km of 11.6 ± 3.7 µM (hOAT1-1) and a Km of 11.9 ± 6.4 µM (hOAT1-2). Consequently, we tested the interaction of PAH, urate, and the diuretic drug furosemide under identical experimental conditions for both isoforms. PAH as the "classical" substrate for OAT1 caused an IC50 of 16 µM for hOAT1-1 and 10 µM for hOAT1-2. These values fit very well to the already known affinities of human OAT1 for PAH (Hosoyamada et al., 1999Go; for review, see Burckhardt et al., 2001Go).

In human beings, fractional excretion of urate is about 10%, supporting the notion that reabsorption dominates secretion (Roch-Ramel and Guisan, 1999Go). A protein playing a major role in the reabsorption process on the apical side of the proximal tubule cell was recently identified and called URAT1 (Enomoto et al., 2002Go). The mechanisms of the basolateral entry/exit of urate are still a matter of debate. hOAT1 was shown to transport urate with a calculated Km of 943 µM (Ichida et al., 2003Go). Our IC50 values for urate of 440 µM for hOAT1-1 and 385 µM for hOAT1-2 are more than 2 times lower than the reported Km value. The normal urate serum concentration was noted to be below 300 µM (Roch-Ramel and Guisan, 1999Go), implying that both isoforms may be involved in urate secretion under normal physiological conditions. Recently, Bakhiya et al. (2003Go) reported on the interaction of hOAT3, with urate providing an IC50 of 255 µM. These data suggest the possible involvement of hOAT1 and hOAT3 in urate secretion.

The effect of furosemide is based on an active secretion in the proximal tubule via probenecid- and PAH-sensitive transport systems (Bidiville and Roch-Ramel, 1986Go). For the rat OAT1 it was reported that it translocates furosemide (Uwai et al., 2000Go). We calculated an IC50 for furosemide of 14 µM for hOAT1-1 and 20 µM for hOAT1-2, illustrating a substantial interaction of the compound with the transport proteins similar to the observed interaction of these splice-variants with PAH. These data suggest that both human isoforms (hOAT1-1 and hOAT1-2) are involved in the secretion of furosemide. This conclusion is supported by the latest findings of Hasannejad et al. (2003Go), who described an IC50 for furosemide of 18 µM for hOAT1. Moreover, they provide evidence that furosemide is translocated by hOAT1.

In summary, we provide evidence for a general expression of the recently identified splice-variants of hOAT1. All four documented hOAT1 isoforms are expressed on the protein level in vitro and in vivo. Their expression is restricted to the kidney cortex. Functional characterizations of hOAT1-1 and hOAT1-2 illustrate that they may contribute to the same extent to the excretion of the substrates tested. The functional impact of hOAT1-3 and hOAT1-4 on organic anion transport still remains open.


    Acknowledgments
 
We thank A. Hillemann, G. Dallmeyer, and S. Petzke for excellent technical assistance, and A. Nolte (Department of Biochemistry, University of Göttingen, Germany) for nucleotide sequencing.


    Footnotes
 
1 Abbreviations used are: OAT, organic anion transporter; OCT, organic cation transporter; hOAT1, human organic anion transporter1; bp, base pair(s); FL, fluorescein; PAH, p-aminohippurate; PBS, phosphate-buffered saline; RT-PCR, reverse transcription-polymerase chain reaction. Back

Address correspondence to: Dr. Andrew Bahn, Zentrum für Physiologie und Pathophysiologie, Abt. Vegetative Physiologie und Pathophysiologie, Universität Göttingen, Humboldtallee 23, 37073 Göttingen, Germany. E-mail: abahn{at}veg-physiol.med.uni-goettingen.de


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 


Bahn A, Hagos Y, and Burckhardt G (2003) Endogenous substrates of the organic anion transporter 1 (OAT1) in kidneys and eyes: anionic metabolites of neurotransmitters. Nova Acta Leopoldina 329: 21-27.

Bahn A, Knabe M, Hagos Y, Rodiger M, Godehardt S, Graber-Neufeld DS, Evans KK, Burckhardt G, and Wright SH (2002) Interaction of the metal chelator 2,3-dimercapto-1-propanesulfonate with the rabbit multispecific organic anion transporter 1 (rbOAT1). Mol Pharmacol 62: 1128-1136.[Abstract/Free Full Text]

Bahn A, Prawitt D, Buttler D, Reid G, Enklaar T, Wolff NA, Ebbinghaus C, Hillemann A, Schulten HJ, Gunawan B, et al. (2000) Genomic structure and in vivo expression of the human organic anion transporter 1 (hOAT1) gene. Biochem Biophys Res Commun 275: 623-630.[CrossRef][Medline]

Bakhiya N, Bahn A, Burckhardt G, and Wolff NA (2003) Human organic anion transporter 3 (hOAT3) can operate as an exchanger and mediate secretory urate flux. Cell Physiol Biochem 13: 249-256.[CrossRef][Medline]

Bidiville J and Roch-Ramel F (1986) Competition of organic anions for furosemide and p-aminohippurate secretion in the rabbit. J Pharmacol Exp Ther 237: 636-643.[Abstract/Free Full Text]

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.[CrossRef][Medline]

Burckhardt BC and Burckhardt G (2003) Transport of organic anions across the basolateral membrane of proximal tubule cells. Rev Physiol Biochem Pharmacol 146: 95-158.[Medline]

Burckhardt G, Bahn A, and Wolff NA (2001) Molecular physiology of renal p-aminohippurate secretion. News Physiol Sci 16: 114-118.[Abstract/Free Full Text]

Burckhardt G and Pritchard JB (2000) Organic anion and cation antiporters, in The Kidney: Physiology & Pathophysiology, 3rd ed, ch 7 (Seldin DW and Giebisch G eds) pp 193-222, Lippincott Williams & Wilkins, Philadelphia.

Burckhardt G, Wolff NA, and Bahn A (2002) Molecular characterization of the renal organic anion transporter 1. Cell Biochem Biophys 36: 169-174.[Medline]

Cihlar T, Lin DC, Pritchard JB, Fuller MD, Mendel DB, and Sweet DH (1999) The antiviral nucleotide analogs cidofovir and adefovir are novel substrates for human and rat renal organic anion transporter 1. Mol Pharmacol 56: 570-580.[Abstract/Free Full Text]

Deguchi T, Kusuhara H, Takadate A, Endou H, Otagiri M, and Sugiyama Y (2004) Characterization of uremic toxin transport by organic anion transporters in the kidney. Kidney Int 65: 162-174.[CrossRef][Medline]

Dresser MJ, Leabman MK, and Giacomini KM (2001) Transporters involved in the elimination of drugs in the kidney: organic anion transporters and organic cation transporters. J Pharm Sci 90: 397-421.[CrossRef][Medline]

Enomoto A, Kimura H, Chairoungdua A, Shigeta Y, Jutabha P, Cha SH, Hosoyamada M, Takeda M, Sekine T, Igarashi T, et al. (2002) Molecular identification of a renal urate anion exchanger that regulates blood urate levels. Nature (Lond) 417: 447-452.[Medline]

George RL, Wu X, Huang W, Fei YJ, Leibach FH, and Ganapathy V (1999) Molecular cloning and functional characterization of a polyspecific organic anion transporter from Caenorhabditis elegans. J Pharmacol Exp Ther 291: 596-603.[Abstract/Free Full Text]

Groves CE, Morales M, and Wright SH (1998) Peritubular transport of ochratoxin A in rabbit renal proximal tubules. J Pharmacol Exp Ther 284: 943-948.[Abstract/Free Full Text]

Hagos Y, Bahn A, Asif AR, Krick W, Sendler M, and Burckhardt G (2002) Cloning of the pig renal organic anion transporter 1 (pOAT1). Biochimie 84: 1219-1222.[CrossRef]

Hasannejad H, Takeda M, Taki K, Jung SH, Babu E, Jutabha P, Khamdang S, Aleboyeh M, Onodera ML, Tojo A, et al. (2003) Interactions of human organic anion transporters with diuretics. J Pharmacol Exp Ther. Nov 10 [Epub ahead of print].

Hayer M, Bonisch H, and Bruss M (1999) Molecular cloning, functional characterization and genomic organization of four alternatively spliced isoforms of the human organic cation transporter 1 (hOCT1/SLC22A1). Ann Hum Genet 63: 473-482.[CrossRef][Medline]

Ho ES, Lin DC, Mendel DB, and Cihlar T (2000) Cytotoxicity of antiviral nucleotides adefovir and cidofovir is induced by the expression of human renal organic anion transporter 1. J Am Soc Nephrol 11: 383-393.[Abstract/Free Full Text]

Hosoyamada M, Sekine T, Kanai Y, and Endou H (1999) Molecular cloning and functional expression of a multispecific organic anion transporter from human kidney. Am J Physiol 276: F122-F128.

Huang X (1994) On global sequence alignment. Comput Appl Biosci 10: 227-235.[Abstract/Free Full Text]

Ichida K, Hosoyamada M, Kimura H, Takeda M, Utsunomiya Y, Hosoya T, and Endou H (2003) Urate transport via human PAH transporter hOAT1 and its gene structure. Kidney Int 63: 143-155.[CrossRef][Medline]

Lazaridis KN, Tietz P, Wu T, Kip S, Dawson PA, and LaRusso NF (2000) Alternative splicing of the rat sodium/bile acid transporter changes its cellular localization and transport properties. Proc Natl Acad Sci USA 97: 11092-11097.[Abstract/Free Full Text]

Leabman MK, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, DeYoung J, Taylor T, Clark AG, Herskowitz I, and Giacomini KM; Pharmacogenetics of Membrane Transporters Investigators (2002) Polymorphisms in a human kidney xenobiotic transporter, OCT2, exhibit altered function. Pharmacogenetics 12: 395-405.[CrossRef][Medline]

Lopez-Nieto CE, You G, Bush KT, Barros EJ, Beier DR, and Nigam SK (1997) Molecular cloning and characterization of NKT, a gene product related to the organic cation transporter family that is almost exclusively expressed in the kidney. J Biol Chem 272: 6471-6478.[Abstract/Free Full Text]

Motohashi H, Sakurai Y, Saito H, Masuda S, Urakami Y, Goto M, Fukatsu A, Ogawa O, and Inui K (2002) Gene expression levels and immunolocalization of organic ion transporters in the human kidney. J Am Soc Nephrol 13: 866-874.[Abstract/Free Full Text]

Plata C, Meade P, Hall A, Welch RC, Vazquez N, Hebert SC, and Gamba G (2001) Alternatively spliced isoform of apical Na+-K+-Cl- cotransporter gene encodes a furosemide-sensitive Na+-Cl- cotransporter. Am J Physiol 280: F574-F582.

Pritchard JB, Sweet DH, Miller DS, and Walden R (1999) Mechanism of organic anion transport across the apical membrane of choroid plexus. J Biol Chem 274: 33382-33387.[Abstract/Free Full Text]

Reid G, Wolff NA, Dautzenberg FM, and Burckhardt G (1998) Cloning of a human renal p-aminohippurate transporter, hROAT1. Kidney Blood Press Res 21: 233-237.[CrossRef][Medline]

Roch-Ramel F and Guisan B (1999) Renal transport of urate in humans. News Physiol Sci 14: 80-84.[Abstract/Free Full Text]

Sekine T, Watanabe N, Hosoyamada M, Kanaim Y, and Endou H (1997) Expression cloning and characterization of a novel multispecific organic anion transporter. J Biol Chem 272: 18526-18529.[Abstract/Free Full Text]

Shimomura A, Chonko AM, and Grantham JJ (1981) Basis for heterogeneity of para-aminohippurate secretion in rabbit proximal tubules. Am J Physiol 240: F430-F436.

Soleimani M and Burnham CE (2001) Na+:HCO3- cotransporters (NBC): cloning and characterization (review). J Membr Biol 183: 71-84.[CrossRef][Medline]

Sweet DH, Wolff NA, and Pritchard JB (1997) Expression cloning and characterization of ROAT1: the renal basolateral organic anion transporter in rat kidney. J Biol Chem 272: 30088-30095.[Abstract/Free Full Text]

Takeda M, Tojo A, Sekine T, Hosoyamada M, Kanai Y, and Endou H (1999) Role of organic anion transporter 1 (OAT1) in cephaloridine (CER)-induced nephrotoxicity. Kidney Int 56: 2128-2136.[CrossRef][Medline]

Tatsumi S, Miyamoto K, Kouda T, Motonaga K, Katai K, Ohkido I, Morita K, Segawa H, Tani Y, Yamamoto H, et al. (1998) Identification of three isoforms for the Na+-dependent phosphate cotransporter (NaPi-2) in rat kidney. J Biol Chem 273: 28568-28575.[Abstract/Free Full Text]

Tojo A, Sekine T, Nakajima N, Hosoyamada M, Kanai Y, Kimura K, and Endou H (1999) Immunohistochemical localization of multispecific renal organic anion transporter 1 in rat kidney. J Am Soc Nephrol 10: 464-471.[Abstract/Free Full Text]

Tsuda M, Sekine T, Takeda M, Cha SH, Kanai Y, Kimura M, and Endou H (1999) Transport of ochratoxin A by renal multispecific organic anion transporter 1. J Pharmacol Exp Ther 289: 1301-1305.[Abstract/Free Full Text]

Urakami Y, Akazawa M, Saito H, Okuda M, and Inui K (2002) cDNA cloning, functional characterization and tissue distribution of an alternatively spliced variant of organic cation transporter hOCT2 predominantly expressed in the human kidney. J Am Soc Nephrol 13: 1703-1710.[Abstract/Free Full Text]

Uwai Y, Saito H, Hashimoto Y, and Inui KI (2000) Interaction and transport of thiazide diuretics, loop diuretics and acetazolamide via rat renal organic anion transporter rOAT1. J Pharmacol Exp Ther 295: 261-265.[Abstract/Free Full Text]

Wolff NA, Werner A, Burkhardt S, and Burckhardt G (1997) Expression cloning and characterization of a renal organic anion transporter from winter flounder. FEBS Lett 417: 287-291.[CrossRef][Medline]

Zhang L, Dresser MJ, Chun JK, Babbitt PC, and Giacomini KM (1997) Cloning and functional characterization of a rat renal organic cation transporter isoform (rOCT1A). J Biol Chem 272: 16548-16554.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
C. D. Cropp, T. Komori, J. E. Shima, T. J. Urban, S. W. Yee, S. S. More, and K. M. Giacomini
Organic Anion Transporter 2 (SLC22A7) Is a Facilitative Transporter of cGMP
Mol. Pharmacol., April 1, 2008; 73(4): 1151 - 1158.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
O. Kwon, S.-M. Hong, and K. Blouch
Alteration in Renal Organic Anion Transporter 1 After Ischemia/Reperfusion in Cadaveric Renal Allografts
J. Histochem. Cytochem., June 1, 2007; 55(6): 575 - 584.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Rizwan, W. Krick, and G. Burckhardt
The Chloride Dependence of the Human Organic Anion Transporter 1 (hOAT1) Is Blunted by Mutation of a Single Amino Acid
J. Biol. Chem., May 4, 2007; 282(18): 13402 - 13409.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
W. M. Henderson and M. A. Smith
Perfluorooctanoic Acid and Perfluorononanoic Acid in Fetal and Neonatal Mice Following In Utero Exposure to 8-2 Fluorotelomer Alcohol
Toxicol. Sci., February 1, 2007; 95(2): 452 - 461.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Eraly, V. Vallon, D. A. Vaughn, J. A. Gangoiti, K. Richter, M. Nagle, J. C. Monte, T. Rieg, D. M. Truong, J. M. Long, et al.
Decreased Renal Organic Anion Secretion and Plasma Accumulation of Endogenous Organic Anions in OAT1 Knock-out Mice
J. Biol. Chem., February 24, 2006; 281(8): 5072 - 5083.
[Abstract] [Full Text] [PDF]


Home page
J Clin PharmacolHome page
O. Q. P. Yin, B. Tomlinson, and M. S. S. Chow
Variability in Renal Clearance of Substrates for Renal Transporters in Chinese Subjects
J. Clin. Pharmacol., February 1, 2006; 46(2): 157 - 163.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Bahn, M. Ljubojevic, H. Lorenz, C. Schultz, E. Ghebremedhin, B. Ugele, I. Sabolic, G. Burckhardt, and Y. Hagos
Murine renal organic anion transporters mOAT1 and mOAT3 facilitate the transport of neuroactive tryptophan metabolites
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1075 - C1084.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bahn, A.
Right arrow Articles by Hagos, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bahn, A.
Right arrow Articles by Hagos, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*FLUORESCEIN
*FUROSEMIDE
*P-AMINOHIPPURIC ACID


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition