0090-9556/04/3209-902-905$20.00
DMD 32:902-905, 2004
SHORT COMMUNICATION
ALTERED PHARMACOKINETICS OF OMEPRAZOLE IN CYSTIC FIBROSIS KNOCKOUT MICE RELATIVE TO WILD-TYPE MICE
Melanie N. Tallman,
Shazia Y. Ali, and
Philip C. Smith
Department of Drug Delivery and Disposition, University of North Carolina at Chapel Hill School of Pharmacy, Chapel Hill, North Carolina
(Received March 10, 2004;
accepted May 28, 2004)
 |
Abstract
|
|---|
The cftrtm1Unc-knockout (CF-KO) mouse is being evaluated as a model of increased drug clearance noted clinically in patients with cystic fibrosis (CF). This study investigated whether CF-KO mice exhibited altered omeprazole pharmacokinetics compared with wild-type mice. Clinical observations have suggested reduced responses to omeprazole in CF children, which may reflect alterations in bioavailability or clearance. Omeprazole was dosed intravenously and orally in a crossover fashion to age-matched CF-KO and wild-type male and female mice. The mean terminal half-life of approximately 6 min was found across genotype and gender groups. Blood to plasma ratio estimates for omeprazole were similar across genders and genotypes with a mean value of 0.69. Omeprazole blood clearance (Clb) was significantly higher in both male (190 ml/min/kg) and female (168 ml/min/kg) CF-KO mice compared with wild-type controls of the same gender (73 ml/min/kg for males and 100 ml/min/kg for females). The distributional volume of omeprazole in CF-KO mice was also statistically higher than in control genotypes. Bioavailability estimates were similar between CF-KO and wild-type females but were unavailable for male mice, due to the large variability in plasma concentrations after oral administration and the difficulty estimating the area under the plasma curve when the terminal half-life suggested absorption rate-limited disposition. Potential mechanisms for the pharmacokinetic differences observed with omeprazole in CF-KO mice may be increased hepatic blood flow or an up-regulation of hepatic transporters. These results may provide support for using the CF-KO mouse as a model for the altered disposition of drugs in CF.
Cystic fibrosis (CF) is a fatal genetic disease that afflicts one in 2500 white newborns in the United States each year (Boucher et al., 2000
). It is inherited in an autosomal recessive manner and is the consequence of any one of a number of altered amino acid sequences of the cystic fibrosis transmembrane conductance regulator chloride channel (CFTR). This malformation is especially detrimental in tissues with a high concentration of CFTR, where electrolyte concentrations are altered both intracellularly and extracellularly. Thick secretions and the associated pathophysiology consequently ensue in the reproductive, digestive, hepatobiliary, and pulmonary systems (Ratjen and Doring, 2003). A high percentage of CF patients experience gastroesophageal reflux disease (GERD) due to a number of mechanisms including poor esophageal sphincter tone and acid hypersection (Gustafsson et al., 1991). To reduce symptoms resulting from GERD, clinicians commonly prescribe the proton pump inhibitor, omeprazole, which blocks gastric acid secretion (Fig. 1). However, according to clinicians, CF patients are often refractory to the effects of omeprazole. Untreated GERD may facilitate a decline in lung function or predispose patients to pneumonias and may necessitate risky surgical procedures to alleviate GERD symptoms (Dab and Malfroot, 1988).
Complicating the treatment of CF patients is the phenomenon of altered pharmacokinetics of numerous structurally diverse compounds, including aminoglycosides, theophylline, penicillins, and nonsteroidal anti-inflammatory drugs (Jusko et al., 1975; Kearns et al., 1982; Isles et al., 1983; Konstan et al., 1991). Reports of increased renal clearance, hepatic blood flow, and hepatic phase I and II metabolism are among the alterations reported in the literature for the CF population. These differences may translate into decreased therapeutic efficacy of the administered medication. For instance, it is recommended to increase empiric dosages of penicillin and derivatives by 20 to 30% for CF patients to account for increases in renal clearance (Rey et al., 1998). To date, no concrete mechanism for the perturbed drug disposition in CF has been elucidated. Because mechanistic studies for altered pharmacokinetics would be technically difficult if conducted in human CF patients, it is desirable to perform these studies in an animal model of the disease. Research in this laboratory has focused upon using the CF-KO mouse for this purpose. Additionally, the potential use of the CF-KO as a model for altered pharmacokinetics in the human CF population is being investigated in our laboratory with promising preliminary results (Kulkarni et al., 2000). There are currently no data to indicate that omeprazole pharmacokinetics have been assessed in human CF patients. A potential cause of the poor response of CF patients treated with omeprazole may be due to alterations in the pharmacokinetics of omeprazole. In this study, the pharmacokinetics of omeprazole in age-matched CF-KO and wild-type mice were determined and compared.
|
Materials and Methods
|
|---|
Animal Treatment and Sampling. CF-KO mice were bred from cftrtm1-UNC knockout males and cftrtm1-UNC heterozygous female mice obtained from the University of North Carolina Cystic Fibrosis Center (Snouwaert et al., 1992). CF-KO mice were selected from heterozygous littermates by their small size and truncated, chalky white teeth (Grubb and Boucher, 1999). The CF phenotype was later confirmed by genotype analysis. Wild-type control mice from which the cftrtm1-UNC knockout was originally generated were housed and bred separately. All mice were allowed free access to food and GoLytely (Braintree Laboratories, Braintree MA), an osmotic agent that prevents intestinal blockage by facilitating evacuation of soft stools (Grubb and Boucher, 1999).
Omeprazole (racemic mixture) and the internal standard (H153/52) were graciously provided by Dr. K. Andersson of Astra (Hässle, Mölndal, Sweden). All other chemicals and solvents used were of reagent grade and obtained through commercial vendors. Omeprazole was prepared for intravenous and oral administration in 40% polyethylene glycol 400/60% 0.015 M sodium bicarbonate (pH 8.3) in a 1 mg/ml solution compounded daily. Wild-type and CF-KO mice (aged 16-20 weeks) received omeprazole by oral gavage (10 mg/kg) and through tail vein injection (5 mg/kg) in a crossover fashion with a 1-week washout period (Hoffmann et al., 1986). Blood samples of 75 µl were taken via tail artery nicks beginning 1 min after omeprazole administration. Subsequent blood samples were taken approximately every 5 min for a period of 25 min postdose. Blood was centrifuged and plasma was stored at -20°C until analysis.
Genotype Analysis. To determine CFTR status, genomic DNA was amplified using the CFTR common primer (CAGTGAAGCTGAGACTGTGAGCTT) and either the CFTR negative primer (ACACTGCTCGAGGGCTAGCCTCTTC) or the CFTR positive primer (CTGTAGTTGGCAAGCTTTGAC) (Koller et al., 1991). The polymerase chain reaction mix contained 30 ng of DNA, 200 µM concentrations each of dATP, dCTP, dGTP, and dTTP (Amersham Biosciences Inc., Piscataway, NJ), 1x PCR Buffer (Invitrogen, Carlsbad, CA), 1.5 mM MgCl2, 1 µM each primer, and 0.25 U Platinum Taq (Invitrogen). PCR cycling conditions included an initial denaturation at 94°C for 2 min, 40 cycles of 93°C for 25 s, 63°C for 45 s, 72°C for 4:05 min, and a final extension at 72°C for 10 min. The 1.3-kb PCR products were resolved by gel electrophoresis on a 1% agarose gel.
Omeprazole Analysis. The assay used to quantitate omeprazole in plasma samples was adapted from a published method (Kobayashi et al., 1992). Briefly, H153/52 (50 ng), 0.5 M potassium phosphate (250 µl, pH 8), sodium chloride (25 mg), and dichloromethane (1.5 ml) was added to each sample. Samples were vortexed and centrifuged at 3000g for 10 min; the lower dichloromethane layer was removed and evaporated under nitrogen. The residue was reconstituted in 150 µl of weak mobile phase (15% acetonitrile). Analysis of a 100-µl aliquot was then performed using a reversed-phase high-performance liquid chromatography system, consisting of a Capcell pak C-18 column (UG 120, 2 mm x 250 mm column, 5-µm particle size; Shiseido, Tokyo, Japan), isocratic pump (LDC Analytical Constametric 4100; LDC Analytica, Riviera Beach, FL), autosampler (AS-100; Bio-Rad, Hercules, CA), and a UV detector (HP1050; Hewlett Packard, Palo Alto, CA). The mobile phase consisted of acetonitrile/0.05 M sodium phosphate buffer (pH 8.5) (23:76, v/v) at a flow rate of 0.4 ml/min. Detection wavelength was fixed at 302 nm. Integration was performed using HP Chemstation software (Hewlett Packard). Standard curves were linear over the omeprazole concentration range of 0.1 to 10 µg/ml with acceptable variability (coefficient of variance 
15%).
For estimation of the blood to plasma ratio, blood (1 ml) was taken from mice via cardiac puncture. Omeprazole (1 µg/ml) was added to whole blood and incubated for 10 to 30 min at 37°C. After centrifugation, the hematocrit was measured and 75-µl aliquots of plasma were stored at -20°C until analysis. Blood to plasma ratio values were calculated using a mass balance approach.
Pharmacokinetic Analysis. Noncompartmental analysis using WinNonlin (Pharsight, Mountain View, CA) provided estimates for area under the plasma concentration time curve (AUC), plasma clearance, half-life (t1/2), and apparent volume of distribution (Vd). The disposition of omeprazole appeared to exhibit one-compartment pharmacokinetics, and the values generated by non-compartment and one-compartment fits to the data were similar (Fig. 2). Intravenous and oral dose-normalized values for AUC were used to approximate bioavailability (F). An estimate for Clb was derived from plasma clearance and the blood to plasma ratio. Pharmacokinetic parameters were compared statistically between genotypes of the same sex using a two-sided student's t test. The criterion for significance was set at 
= 0.05.
View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2. Representative concentration versus time profile for a male wild-type mouse after an oral ( ) and i.v. (x) dose of omeprazole.
|
|
|
Results and Discussion
|
|---|
Generation of CF-KO mice has lead to increased knowledge about the precise function of CFTR in relation to ion transport and the role of compensatory transporters in organ systems relatively unaffected by the absence of CFTR. Applications of CF-KO mice also extend to efficacy assessments of medications and gene transfer studies (Grubb and Boucher, 1999). In much the same way, the use of the CF-KO mice may be extended to assess the phenomenon of altered disposition of drugs in CF patients. In the present study, the primary pharmaco-kinetic parameters of omeprazole were found to be significantly different in CF-KO mice (Fig. 3; Table 1). Omeprazole distributes into a larger apparent volume of distribution in the CF-KO compared with wild-type mice by roughly 2-fold when normalized to body weight. Increases in Vd in CF patients have been documented in the literature for several drugs when normalized to body weight, including theophylline and gentamicin (Kearns et al., 1982; Isles et al., 1983). These differences in Vd may be due to altered tissue distribution in response to changes in uptake or efflux transporters; however, when differences in body surface area or lean body mass are accounted for, some investigators report that no significant differences exist between patient populations (Rey et al., 1998). In CF patients, it has been noted that blood and plasma volume is higher than normal and is related to the severity of pulmonary disease (Rosenthal et al., 1977). This may be less relevant in CF-KO mice, since there are no apparent pulmonary sequelae associated with the lack of CFTR (Grubb and Boucher, 1999).
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3. Omeprazole concentration (normalized to 5 mg/kg) versus time for CF-KO () and wild-type (x) for male (A) and female (B) mice after an i.v. dose. Each symbol represents a single plasma measurement from a single mouse.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1 Noncompartmental pharmacokinetic parameters of omeprazole in CF-KO mice and wild-type controls
Data are represented as mean ± standard deviation. Statistical comparisons were performed between wild-type and CF-KO mice of the same gender.
|
|
Initial estimates of plasma clearance revealed that clearance of omeprazole in some mice was higher than hepatic blood flow (Davies and Morris, 1993). To ensure that these values were not artifacts of preferential binding to red blood cells, plasma clearance was converted to Clb using an average blood to plasma ratio estimate of 0.69, which was not significantly different between genotypes or sexes (data not shown). The Clb of omeprazole in CF-KO mice was statistically higher in male (p < 0.001) and female mice (p < 0.01) relative to wild-type controls. The half-life of omeprazole in all mice was approximately 6 min, with no difference between genotypes.
In addition to alterations in clearance, decreases in bioavailability (F) in CF patients may explain poor responses to omeprazole. Thus, mice were also given 10 mg/kg omeprazole orally to assess this possibility. As seen in Table 1, the values for F determined for female CF-KO and wild-type mice were similar, though highly variable. For some male mice, there were not a sufficient number of quantifiable points to determine an AUC. Omeprazole is acid-labile and may have degraded upon passage through the stomach, especially after the first single dose, prior to a reduction in gastric pH by omeprazole (Pilbrant and Cederberg, 1985). Higher doses could have been used in the study for ease of analysis; however, in rats, doses higher than 10 mg/kg resulted in saturation of first-pass metabolism (Watanabe et al., 1994). For other male mice, the terminal phases from the concentration versus time profiles after i.v. and p.o. administration were clearly not parallel, indicating that absorption was the rate-limiting factor in omeprazole systemic disposition in the male mouse (Fig. 2). Due to apparent rate-limiting absorption, a large portion of the AUC would need to be estimated by extrapolation, potentially introducing significant error.
In rodents, dogs, and humans, metabolism is the primary route of omeprazole elimination (Regardh et al., 1985; Hoffmann et al., 1986; Watanabe et al., 1994). In urine and bile, no unchanged omeprazole is detected in these species (Regardh et al., 1985; Hoffmann et al., 1986). Drugs that have higher renal clearance values in CF patients typically are cleared 1.5- to 3-fold faster relative to non-CF patients (Rey et al., 1998). Because omeprazole metabolism is so efficient and rapid, modest changes in alternate clearance routes such as those seen with renal clearance would probably not be sufficient to significantly alter total systemic Clb. Indeed, in CF-KO and wild-type mice of both genders, less than 1% of an i.v. omeprazole dose was subject to renal clearance (data not shown). Thus, it is likely that the rate-limiting step in the hepatic disposition of omeprazole in wild-type mice is enhanced in CF-KO mice, increasing Clb. Based upon the clearance values in Table 1 and the assumption that clearance processes occur exclusively through the liver, omeprazole clearance is a high-extraction ratio compound in mice, considering that murine hepatic blood flow is approximately 90 ml/min/kg (Davies and Morris, 1993). Therefore, an increase in metabolic efficiency would probably not cause an appreciable increase in Clb because hepatic blood flow limits metabolic clearance. However, analysis of a few very early time points indicate that omeprazole may have a rapid distribution phase after an i.v. dose. Because of the difficulty in characterizing a rapid distribution phase in mice, values for AUC may be underestimated, leading to an overestimation of Clb. If this is true, omeprazole may be an intermediately extracted drug in wild-type mice, and the increase in Clb observed in CF-KO mice may be due to increased rates of metabolism, among other reasons. Because metabolism may not be the rate-limiting step in disposition in wild-type mice, alternative explanations for the observed clearance differences may be due to increased hepatic uptake or blood flow.
Omeprazole disposition in CF-KO mice may be different due to an alteration in transporters, a feasible hypothesis since omeprazole is quite polar as well as a transporter substrate, and evidence exists that some transporter expression is enhanced when CFTR expression is low or absent. In porcine kidney cells transfected with MDR-1, polarized transport of omeprazole toward the apical membrane was observed which could not be reversed by an MDR-1 inhibitor (PSC-833), indicating primary involvement of another transporter (Pauli-Magnus et al., 2001). CFTR belongs to the ATP-binding cassette superfamily of transporters and shares significant homology and chloride channel activity with transporters in this superfamily such as the multidrug resistance-associated proteins and MDR-1 that also transport drugs (Valverde et al., 1992; Croop, 1998). In a series of studies, mRNA levels of CFTR and MDR-1 exhibited complementary patterns of expression in various tissue systems (Trezise et al., 1992). Indeed, in the cftrtm1CAM knockout, a compensatory up-regulation of MDR-1 was observed in the intestine (Trezise et al., 1997). The phenomenon of transporter coordinate regulation is well documented in cholestasis and multidrug resistance-associated protein-2-deficient animals (Donner and Keppler, 2001). Hepatocyte uptake via transporters may be up-regulated in CF-KO mice, which could explain elevations in clearance in the latter genotype if this is rate-limiting for omeprazole. Assessment of changes in putative uptake transporters for omeprazole was not feasible in the mouse model due to the lack of available specific antibodies to murine transporters.
To add confidence to the idea that the CF-KO may be used as a model for the altered disposition in CF, a clinical study currently is being proposed for omeprazole to assess possible differences in humans. Should these changes of omeprazole disposition in the CF-KO mouse correlate with the changes observed in CF patients, the murine model for drug disposition in CF may allow for more rapid optimization of drug therapy in clinical practice.
|
Footnotes
|
|---|
This study was funded in by the Cystic Fibrosis Foundation and an Under-graduate Research Fellowship in Pharmaceutics from the PhRMA Foundation.
ABBREVIATIONS: CF, cystic fibrosis; CF-KO, cftrtm1-UNC cystic fibrosis knockout mouse; Clb, blood clearance; CFTR, cystic fibrosis transmembrane conductance regulator protein; GERD, gastroesophageal reflux; AUC, area under the plasma concentration versus time curve; t1/2, half-life; Vd, volume of distribution; F, bioavailability; MDR-1, multidrug resistance protein-1; PSC-833, valspodar.
Address correspondence to: Philip C. Smith, University of North Carolina at Chapel Hill, CB#7360, 1318 Kerr Hall, Chapel Hill NC 27599. E-mail: pcs{at}email.unc.edu
|
References
|
|---|
Boucher R, Knowles M, and Yankaskas J (2000) Cystic fibrosis, in Textbook of Respiratory Medicine (Murray J and Nadel J eds) pp 1291-1323, WB Saunders, Philadelphia.
Croop JM (1998) Evolutionary relationships among ABC transporters. Methods Enzymol 292: 101-116.[CrossRef][Medline]
Dab I and Malfroot A (1988) Gastroesophageal reflux: a primary defect in cystic fibrosis? Scand J Gastroenterol Suppl 143: 125-131.[Medline]
Davies B and Morris T (1993) Physiological parameters in laboratory animals and humans. Pharm Res (NY) 10: 1093-1095.
Donner MG and Keppler D (2001) Up-regulation of basolateral multidrug resistance protein 3 (Mrp3) in cholestatic rat liver. Hepatology 34: 351-359.[CrossRef][Medline]
Grubb BR and Boucher RC (1999) Pathophysiology of gene-targeted mouse models for cystic fibrosis. Physiol Rev 79: S193-S214.
Gustafsson PM, Fransson SG, Kjellman NI, and Tibbling L (1991) Gastro-oesophageal reflux and severity of pulmonary disease in cystic fibrosis. Scand J Gastroenterol 26: 449-456.[Medline]
Hoffmann KJ, Renberg L, and Olovson SG (1986) Comparative metabolic disposition of oral doses of omeprazole in the dog, rat and mouse. Drug Metab Dispos 14: 336-340.[Abstract]
Isles A, Spino M, Tabachnik E, Levison H, Thiessen J, and MacLeod S (1983) Theophylline disposition in cystic fibrosis. Am Rev Respir Dis 127: 417-421.[Medline]
Jusko WJ, Mosovich LL, Gerbracht LM, Mattar ME, and Yaffe SJ (1975) Enhanced renal excretion of dicloxacillin in patients with cystic fibrosis. Pediatrics 56: 1038-1044.[Abstract/Free Full Text]
Kearns GL, Hilman BC, and Wilson JT (1982) Dosing implications of altered gentamicin disposition in patients with cystic fibrosis. J Pediatr 100: 312-318.[CrossRef][Medline]
Kobayashi K, Chiba K, Sohn DR, Kato Y, and Ishizaki T (1992) Simultaneous determination of omeprazole and its metabolites in plasma and urine by reversed-phase high-performance liquid chromatography with an alkaline-resistant polymer-coated C18 column. J Chromatogr 579: 299-305.[Medline]
Koller BH, Kim HS, Latour AM, Brigman K, Boucher RC Jr, Scambler P, Wainwright B, and Smithies O (1991) Toward an animal model of cystic fibrosis: targeted interruption of exon 10 of the cystic fibrosis transmembrane regulator gene in embryonic stem cells. Proc Natl Acad Sci USA 88: 10730-10734.[Abstract/Free Full Text]
Konstan MW, Hoppel CL, Chai BL, and Davis PB (1991) Ibuprofen in children with cystic fibrosis: pharmacokinetics and adverse effects. J Pediatr 118: 956-964.[CrossRef][Medline]
Kulkarni SG, Pegram AA, and Smith PC (2000) Disposition of acetaminophen and indocyanine green in cystic fibrosis-knockout mice. AAPS Pharm Sci 2: E18.
Pauli-Magnus C, Rekersbrink S, Klotz U, and Fromm MF (2001) Interaction of omeprazole, lansoprazole and pantoprazole with P-glycoprotein. Naunyn-Schmiedeberg's Arch Pharmacol 364: 551-557.[CrossRef][Medline]
Pilbrant A and Cederberg C (1985) Development of an oral formulation of omeprazole. Scand J Gastroenterol Suppl 108: 113-120.[Medline]
Ratjen F and Doring G (2003) Cystic fibrosis. Lancet 361: 681-689.[CrossRef][Medline]
Regardh CG, Gabrielsson M, Hoffman KJ, Lofberg I, and Skanberg I (1985) Pharmacokinetics and metabolism of omeprazole in animals and man—an overview. Scand J Gastroenterol Suppl 108: 79-94.[Medline]
Rey E, Treluyer JM, and Pons G (1998) Drug disposition in cystic fibrosis. Clin Pharmacokinet 35: 313-329.[CrossRef][Medline]
Rosenthal A, Button LN, and Khaw KT (1977) Blood volume changes in patients with cystic fibrosis. Pediatrics 59: 588-594.[Abstract/Free Full Text]
Snouwaert JN, Brigman KK, Latour AM, Malouf NN, Boucher RC, Smithies O, and Koller BH (1992) An animal model for cystic fibrosis made by gene targeting. Science (Wash DC) 257: 1083-1088.[Abstract/Free Full Text]
Trezise AE, Ratcliff R, Hawkins TE, Evans MJ, Freeman TC, Romano PR, Higgins CF, and Colledge WH (1997) Co-ordinate regulation of the cystic fibrosis and multidrug resistance genes in cystic fibrosis knockout mice. Hum Mol Genet 6: 527-537.[Abstract/Free Full Text]
Trezise AE, Romano PR, Gill DR, Hyde SC, Sepulveda FV, Buchwald M, and Higgins CF (1992) The multidrug resistance and cystic fibrosis genes have complementary patterns of epithelial expression. EMBO (Eur Mol Biol Organ) J 11: 4291-4303.[Medline]
Valverde MA, Diaz M, Sepulveda FV, Gill DR, Hyde SC, and Higgins CF (1992) Volume-regulated chloride channels associated with the human multidrug-resistance P-glycoprotein. Nature (Lond) 355: 830-833.[CrossRef][Medline]
Watanabe K, Furuno K, Eto K, Oishi R, and Gomita Y (1994) First-pass metabolism of omeprazole in rats. J Pharm Sci 83: 1131-1134.[CrossRef][Medline]
![[Feedback]](/icons/banner/feedbackACT.gif)
![[For Subscribers]](/icons/banner/subscriberACT.gif)
![[Archive]](/icons/banner/archiveACT.gif)
![[Search]](/icons/banner/searchACT.gif)
![[Contents]](/icons/banner/tocACT.gif)
Top
Abstract
Materials and Methods
