DMD Simcyp

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Drug Metabolism and Disposition Fast Forward
First published on November 30, 2004; DOI: 10.1124/dmd.104.001800


0090-9556/05/3303-458-465$20.00
DMD 33:458-465, 2005

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dmd.104.001800v1
33/3/458    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaniwa, N.
Right arrow Articles by Hasegawa, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaniwa, N.
Right arrow Articles by Hasegawa, R.

RACIAL VARIABILITY IN HAPLOTYPE FREQUENCIES OF UGT1A1 AND GLUCURONIDATION ACTIVITY OF A NOVEL SINGLE NUCLEOTIDE POLYMORPHISM 686C> T (P229L) FOUND IN AN AFRICAN-AMERICAN

Nahoko Kaniwa, Kouichi Kurose, Hideto Jinno, Toshiko Tanaka-Kagawa, Yoshiro Saito, Mayumi Saeki, Jun-ichi Sawada, Masahiro Tohkin, and Ryuichi Hasegawa

Division of Medicinal Safety Science (N.K., K.K., M.T., R.H.), Division of Environmental Chemistry (H.J., T.T-K.), and Project Team for Pharmacogenetics (Y.S., M.S., J.S.), National Institute of Health Sciences, Tokyo, Japan

(Received August 10, 2004; Accepted November 23, 2004)


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Ethnic differences in genetic polymorphisms in UDP-glucuronosyltransferase 1A1 (UGT1A1) were investigated among African-Americans, Caucasians, and Japanese using samples obtained from 150 individuals for each population. Genotyping of –3279T>G in the phenobarbital-responsive enhancer module, TA repeats in the TATA box, 211G>A (G71R) and 686C>A (P229Q) in exon 1, and three single nucleotide polymorphisms (SNPs) (1813C> T, 1941C>G, and 2042C>G) in the 3'-untranslated region in exon 5 was performed. Eight haplotypes of block 1 (exon 1 and its 5'-flanking region) harboring the first four variations were assigned to each individual. The dominant haplotype for African-Americans was *28b (–3279G;TA7; 211G;686C) (0.446), whereas that for the Japanese was *1a (–3279T; TA6;211G;686C) (0.610). Frequencies of the two haplotypes *1a and *28b were comparable in Caucasians. Haplotype *6a (–3279T;TA6; 211A;686C) was characteristic of the Japanese, whereas haplotypes *36b and *37b (–3279T;TA5 and TA8;211G;686C) were found mostly in African-Americans. Although the three SNPs in block 2 (exons 2–5) were in complete linkage in the Japanese, they were not completely linked in African-Americans or Caucasians. These differences in haplotype distribution patterns among the three populations suggest the possibility of ethnic differences in toxicity profiles of drugs detoxicated by UGT1A1. A novel SNP, 686C>T (P229L), was found in an African-American. The intrinsic clearance of 7-ethyl-10-hydroxycamptothecin (SN-38) by P229L UGT1A1 expressed in COS-1 cells was about 3% of the wild type. The results of Western blotting and real-time reverse transcription-polymerase chain reaction suggest that the low glucuronidation activity of the variant was partly due to its low stability. The variation 686C>T may cause high toxicity during 7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin (CPT-11) therapy or hyperbilirubinemia in patients.


UDP-glucuronosyltransferases catalyze the glucuronidation of various lipophilic endogenous and exogenous substances including drugs and environmental toxicants to produce glucuronides. UDP-glucuronosyltransferase 1A1 (UGT1A1) is a member of the UGT1A family and is exclusively involved in the metabolism of bilirubin (Tukey and Strassburg, 2000Go). It is also known to glucuronidate 7-ethyl-10-hydroxycamptothecin (SN-38), the active metabolite of an anticancer drug, irinotecan (CPT-11; 7-ethyl-10-[4-(1-piperidino)-1-piperidino] carbonyloxycamptothecin), to form inactive 7-ethyl-10-hydroxycamptothecin glucuronide (SN-38G) (Iyer et al., 1998Go; Hanioka et al., 2001Go). Since SN-38 is associated with severe diarrhea due to administration of CPT-11 (Araki et al., 1993Go), detoxication of SN-38 by UGT1A1 could play a significant role in protecting against the severe side effects caused by CPT-11.

The wide interindividual variability in SN-38G formation in hepatic tissues is known and has been shown to correlate with UGT1A1 genetic polymorphisms (Iyer et al., 1999Go). To date, a wide variety of allelic polymorphisms of human UGT1A1 have been reported, most of which lead to a partial or complete deficiency of enzyme activity and are associated with diseases, such as the Criegler-Najjar (CN) syndrome types I and II or Gilbert's syndrome, with hyperbilirubinemia and jaundice as main symptoms (http://som.flinders.edu.au/FUSA/ClinPharm/UGT/1A1aalleles.html; Mackenzie et al., 1997Go; Tukey and Strassburg, 2000Go). To understand these syndromes and their possible genetic causes, polymorphisms in the TATA box have been the most extensively studied. An inverse relationship between the number of TA repeats (five to eight) and transcriptional activity has been reported (Beutler et al., 1998Go). It has been reported that serum bilirubin levels in individuals with seven TA repeats are higher than the levels in individuals without a seventh repeat (Bosma et al., 1995Go; Raijmakers et al., 2000Go). Patients suffering from Gilbert's syndrome, CN syndrome, or prolonged neonatal jaundice also often carry seven or eight TA repeats (Iolascon et al., 1999Go; Burchell et al., 2000Go). The UGT1A1 promoter polymorphisms are also considered a determinant of CPT-11 disposition and toxicity (Iyer et al., 1999Go; Ando et al., 2000Go; Iyer et al., 2002Go). Other variations often associated with neonatal hyperbilirubinemia, CN syndromes, Gilbert's disease, or irinotecan toxicity are 211G>A (G71R), 1456T>G (Y486D), and 686C>A (P229Q) (Ando et al., 2000Go; Kraemer and Klinker, 2002Go; Yamamoto et al., 2002Go) (In this report, the A of the translational start codon of the cDNA is designated 1.) Recently, the possibility of a synergistic effect of 3'-untranslated region variations with –3279T>G on the bilirubin level and SN-38 pharmacokinetics was also proposed (Sai et al., 2004Go). The single nucleotide polymorphism (SNP) –3279T>G is located in the phenobarbital-responsive enhancer module, which is involved in activation of UGT1A1 transcription by the constitutive androstane receptor (Sugatani et al., 2002Go).

A recent pharmacogenetic study has suggested that there are advantages in the use of haplotypes rather than individual SNPs to investigate the association between genotypes and phenotypes (Judson et al., 2000Go). Racial variability in haplotype frequencies of UGT1A1 may contribute to an interpretation of the racial diversity of pharmacokinetics and toxicity of drugs metabolized by the enzyme. Recently, Sai et al. (2004Go) revealed the haplotype structure of UGT1A1 in Japanese cancer patients using –3279T>G, TA repeats in the TATA box, 211G>A, 686C>A, and three SNPs (1813C>T, 1941C>G, and 2042C>G) in the 3'-untranslated region in exon 5 as markers. Therefore, we studied in this report the differences in the haplotype frequencies of UGT1A1 among African-American, Caucasian, and Japanese populations using genomic DNA obtained from 150 individuals in each population, assessing the genotypes of these markers with dideoxy sequencing and pyrosequencing methods previously reported by Saeki et al. (2003Go). The function of a novel SNP 686C>T (P229L) that was found in an African-American individual during this study was also investigated by utilizing a heterologous expression system with COS-1 cells.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Materials. SN-38 (lot 970507R) and SN-38G (lot 970507R) were kindly supplied by Yakult Honsha Co. Ltd. (Tokyo, Japan). COS-1 cells were obtained from the Health Science Research Resources Bank (Osaka, Japan). Other chemicals used were all reagent grade.

Peripheral Blood Samples. One hundred fifty peripheral blood samples were obtained from healthy Japanese volunteers, 100 of which were kindly provided by Professor Ichiro Ieiri from the Tottori University Hospital with permission of the ethics committees of the Tottori University Faculty of Medicine. Written informed consent was obtained from all participants. Peripheral blood samples of healthy Caucasian and African-American volunteers (150 each) were purchased from the Tennessee Blood Service Corporation (Memphis, TN). The ethics committee of the National Institute of Health Sciences approved this study.

UGT1A1 Genotyping by Pyrosequencing and Dideoxy Sequencing. Genotyping of UGT1A1 using Pyrosequence methods was performed as previously reported (Saeki et al., 2003Go). Briefly, genomic DNA (10–15 ng) was amplified by Ex-Taq (1 U; Takara Shuzo, Ootsu, Japan) with a specific primer pair in which one of the primers was biotinylated. The primers for amplification and sequencing used for detection of polymorphisms –3279T>G, the TA repeat, 211G>A (G71R), and 686C>A/T (P229Q/L) have been shown previously (Saeki et al., 2003Go). Genotyping of 1941C>G for the Japanese samples was performed using an amplification primer pair (biotin-ATTTGAATATG-TATCGTGCCC and CATTCATTCATTTCACCTACACT) and a sequencing primer (CAGTAGGGGCAGC). Generation of the single-stranded fragment and annealing of the sequencing primers have been described previously (Saeki et al., 2003Go). Genotypes were determined using the PSQ 96MA (Biostage AB, Uppsala, Sweden) and the PSQ 96 SNP reagent set (Biostage AB). Genotyping of 1813C>T, 1941C>G, and 2042C>G for African-American and Caucasian samples as well as the detection of a genotype 686C>T in the African-American individual were done by dideoxy sequencing as reported previously (Saeki et al., 2002Go; Sai et al., 2004Go).

Haplotype Analysis. Genotyping was successfully determined for 150 Japanese, 147 Caucasians, and 148 African-Americans. Diplotypes (combinations of haplotypes) in both blocks 1 and 2 were inferred separately for each population by PHASE version 2.0 (Stephens et al., 2001Go; Stephens et al., 2003).

Expression and Enzyme Assay of Wild-Type and Variant UGT1A1s. Expression of wild-type and variant UGT1A1s in COS-1 cells was carried out as described previously (Jinno et al., 2003bGo) with a minor modification; attB-flanked UGT1A1 cDNA was amplified by the two-step attB adaptor polymerase chain reaction (PCR) (Jinno et al., 2003aGo) using pcDNA3.1-UGT1A1/WT (Jinno et al., 2003bGo) as a template and gene-specific primers, 5'-AAAAAGCAGGCTGCAAAGGCGCCATGGCTGT-3' and 5'-AGAAA-GCTGGGTCTCAATGGGTCTTGGATTTGTGGG-3'. The resulting PCR fragment was cloned into the pDONR201 vector (Invitrogen, Carlsbad, CA). The 686C>T mutation was introduced into the wild-type UGT1A1 cDNA clone in pDONR201, using a QuickChange multisite-directed mutagenesis kit (Stratagene, La Jolla, CA) with the 5'-phosphorylated oligonucleotide primer 5'-phospho-GCGACGTGGTTTATTCCCTGTATGCAACCCTTGCCTC-3' (the nucleotide base changed is underlined). Subcloning of each UGT1A1 fragment from pDONR201 into pcDNA-DEST40, a mammalian expression vector, was performed by the Gateway LR reaction.

Expression levels of UGT1A1 mRNA and protein were determined as described previously (Jinno et al., 2003bGo). SN-38 glucuronidation activity of the wild-type and P229L variant UGT1A1 was assayed according to the method of Hanioka et al. (2001Go).

Data Analysis. The {chi}2 test in the SAS Preclinical Package (SAS Institute Japan Ltd., Tokyo, Japan) was applied to s x r contingency tables for comparison of genotype frequencies and analysis of haplotype distribution patterns among the three ethnic groups. In vitro Michaelis-Menten kinetic parameters were estimated by nonlinear regression analysis using Prism version 3.0 (GraphPad Software Inc., San Diego, CA). The average values of the kinetic parameters were calculated using results from three independent preparations. The t test supplied in Prism version 3.0 was applied to the comparison of the average values of protein expression and mRNA levels between wild-type and variant UGT1A1 at a significance level of 0.05.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Differences in Allele Frequencies among Three Ethnic Groups. Allele frequencies of polymorphisms in UGT1A1 tested in this study are summarized in Table 1. The estimated allele frequency of –3279T>G (UGT1A1*60; for UGT1A1 allele nomenclature refer to Mackenzie et al., 1997Go and http://som.flinders.edu.au/FUSA/ClinPharm/UGT/1A1aalleles.htm) was 0.847, 0.550, and 0.257 in African-Americans, Caucasians, and Japanese, respectively, and they were significantly different (p < 0.0001 by the {chi}2 test). Regarding the variation in the TATA box, the allele TA6 was most common in the Japanese population, whereas frequencies of TA6 and TA7 (UGT1A1*28) were equally frequent in African-Americans. The allele frequencies of TA5 (UGT1A1*36) or TA8 (UGT1A1*37) in African-Americans were about 5%, but no carriers with TA5 or TA8 were found in the Japanese. The allele distribution patterns for the wild-type and three variants in the TATA box of the three ethnic groups were significantly different (p < 0.0001 by the {chi}2 test). The variant 211G>A (G71R) (UGT1A1*6) was frequently found in the Japanese population, but not in the Caucasians population (only two heterozygous subject), and none were found in African-Americans. The variant 686C>A (P229Q) (UGT1A1*27) was very rare in all the ethnic groups, and only one heterozygous carrier was found in the Japanese group. A novel variation in the same position as the variant 686C>A, but with a different nucleotide change (686C>T), was found in an African-American. This novel variant led to an amino acid change from proline to leucine (P229L). Pyrograms for 686C/C, 686C/A, and 686 C/T are compared in Fig. 1A and the nucleotide change of the novel variant was confirmed by the dideoxy sequencing method (Fig. 1B). This is the first report detailing allele frequencies of three SNPs in the 3'-untranslated region in exon 5, 1813C>T, 1941C>G and 2042C>G in African-Americans and Caucasians. The frequencies of 1813C>T and 2042C>G in the Japanese were not determined in this study, because these alleles were reported to be in complete association with 1941C>G in a Japanese population without exception (Sai et al., 2004Go; unpublished data). Therefore, allele frequencies of 1813C>T and 2042C>G in the Japanese were assumed to be equal to that of 1941C>G. On the other hand, we found that 1813C>T and 2042C>G were not always in association with 1941C>G in African-Americans and Caucasians, as shown in Table 1. The allele frequencies of the three SNPs were highest in African-Americans and lowest in the Japanese. Significant differences in the allele frequencies were detected (p < 0.0001, p = 0.0074, and p < 0.0001 for 1813C>T, 1941C>G, and 2042C>G, respectively, by the {chi}2 test).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Allele frequencies of genetic polymorphisms of UGT1A1 in three ethnic groups

 


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1. Pyrosequencing and dideoxy sequencing methods for position 686. A, pyrograms for UGT1A1 686C/C, 686C/A, and 686C/T. The sequence to be analyzed is underlined in GACGTGGTTTATTCCCCGTATG. The first T and the fourth C, nucleotides unrelated to 686C>A, were added to estimate the background value. Top, a pyrogram obtained from a Japanese individual carrying homozygous 686C; middle, a pyrogram obtained from a Japanese individual with 686C/A; bottom, a pyrogram obtained from an African-American with 686C/T. B, the nucleotide sequence around the 686th nucleotide in exon 1 is shown (the A of the translational start codon of the cDNA is designated as 1). The sequence of the sense strand obtained from the same individual as in the bottom of A is shown. The arrow indicates the nucleotide substitution position.

 

Differences in Haplotype Frequencies. Sai et al. (2004Go) previously reported that UGT1A1 could be divided into two blocks, with the transcription-regulating and promoter regions and exon 1 in block 1, and exons 2 to 5 in block 2, according to linkage disequilibrium analysis. Therefore, haplotype/diplotype analysis was performed using four marker variations in block 1 (–3279T>G, 211G>A, and 686C>A, and the TATA box), and three marker variations in block 2 (1813C>T, 1941C>G, and 2042C>G). The diplotype configurations (combinations of haplotypes) were estimated for each subject by PHASE software (Stephens et al., 2001Go; Stephens et al., 2003).

Concerning block 1, the diplotype configurations were inferred with greater than 0.99 certainties for 145 Japanese, 144 Caucasians, and 147 African-Americans. The haplotypes identified are summarized in Table 2 along with their frequencies for each population, where the 14 subjects with ambiguous diplotypes were excluded. We followed the haplotype nomenclature previously reported (Sai et al., 2004Go). One Japanese subject carrying heterozygous 686C>A also carried homozygous TA7. Thus, the association of variation 686C>A with TA7 was also confirmed in this study, as previously reported by Huang et al. (2000Go) and Sai et al. (2004Go). A new haplotype, designated *6d, having variations in both positions –3279 and 211, was identified that was not found in the previous study (Sai et al., 2004Go). We could not determine whether the novel variation 686T and the *28 allele were on the same chromosome, because the subject with 686T carried heterozygous TA repeats, TA6/TA7.


View this table:
[in this window]
[in a new window]
 
TABLE 2 Haplotypes in block 1 (the enhancer/promoter regions and exon 1) of UGT1A1 for three ethnic groups

Haplotype distribution patterns in block 1 were statistically different among the three ethnic groups (p < 0.0001 by the {chi}2 test). Fourteen subjects with ambiguous diplotypes were excluded from the analysis.

 

In block 1, haplotype *1a was predominant in the Japanese population (0.61 in frequency). In contrast, its frequencies in Caucasians and African-Americans were 0.45 and 0.15, respectively. Major haplotypes in African-Americans were *28b and *60a. Haplotype frequencies of *1a and *28b in Caucasians were comparable. Thus, the haplotype distribution patterns in block 1 for the individual populations were significantly different (p < 0.0001 by the {chi}2 test).

In block 2, the diplotype configurations using the three SNPs were inferred with certainties greater than 0.98 for all Caucasians and African-Americans (150 each). The haplotypes and their frequencies are summarized in Table 3. Four novel haplotypes, *IC, *ID, *IE, and *IF, were identified in the Caucasian and African-American populations, although *IE was not found in the latter. These haplotypes were not found in the Japanese, as shown in a previous study (Sai et al., 2004Go). Although the three SNPS were reported to be completely associated with each other in the Japanese (Sai et al., 2004Go), they were not always linked with each other in the rest of the populations. However, it is noteworthy that 1941G allele was always associated with 1813T and 2042G alleles except for the haplotype *IE, found only in two Caucasians. Haplotype *IA was predominant for all ethnic groups. The second major haplotype was *IB in both the Japanese and Caucasians. However, the frequencies of *IB and *IC were similar in African-Americans (0.183 and 0.163, respectively). The haplotype *IC was also found in Caucasians (0.06). Thus, the haplotype distribution patterns in block 2 for the three populations were also significantly different (p < 0.0001 by the {chi}2 test).


View this table:
[in this window]
[in a new window]
 
TABLE 3 Haplotypes in block 2 (exons 2–5) of UGT1A1 for three ethnic groups

Haplotype distribution patterns in block 2 were statistically different among the three ethnic groups (p < 0.0001 by the {chi}2 test).

 

Expression and SN-38 Glucuronidation of a Novel Variant P229L Compared with Wild-Type UGT1A1. The relative expression level of the novel variant UGT1A1/P229L in the membrane fraction of COS-1 cells was determined by Western blotting using a polyclonal anti-human UGT1A antibody (Fig. 2). Because two bands, one at the same position as the wild-type and the other at a higher molecular weight, were detected for P229L, the total chemiluminescence of the two bands was used to calculate the protein expression level for P229L. The protein expression level of P229L was approximately 60% of the wild type, and this difference was statistically significant by the t test (p = 0.044). The UGT1A1 mRNA expression level was then measured by real-time reverse transcription-PCR (RT-PCR) using SYBR Green. As shown in Fig. 3, however, no significant difference in the mRNA level was detected among the COS-1 cells transfected with the expression plasmids carrying wild-type and P229L UGT1A1 cDNAs.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 2. Expression of wild-type and variant P229L UGT1A1 in COS-1 cells. A, an aliquot (20 µg) of the pooled membrane fractions from three independent preparations was subjected to SDS-polyacrylamide gel electrophoresis, electrophoretically transferred to a polyvinylidene difluoride membrane, and immunochemically detected with a rabbit anti-human UGT1A antiserum. The membrane was subsequently stripped and reprobed with a rabbit anti-calnexin antiserum to confirm that the samples were evenly loaded. B, each Western blot from three independent preparations was quantified densitometrically, and the expression level of UGT1A1 proteins was normalized to that of the wild type. The results are expressed as the mean ± S.E.M. from three independent preparations. The expression level of UGT1A1 proteins of P229L was significantly lower than that of the wild type (p = 0.044).

 


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 3. Quantification of UGT1A1 mRNA by real-time SYBR Green RT-PCR in COS-1 cells transfected with wild-type and variant P229L UGT1A1. UGT1A1 mRNA from the cellular total RNA samples was quantified by SYBR Green RT-PCR. Each sample was normalized on the basis of the ß-actin content and expressed as a percentage of the wild type. The results indicate the mean ± S.E.M. from three independent preparations. No significant difference in mRNA level was observed between the wild type and P229L (p = 0.180).

 

The glucuronidation activity of SN-38 by P229L expressed in COS-1 cells was compared with that of the wild-type under 11 substrate concentrations ranging from 2.5 to 150 µM. The representative curves of the Michaelis-Menten kinetics are shown in Fig. 4, and the estimated apparent kinetic parameters (Km, Vmax, and Vmax/Km) are summarized in Table 4. Vmax values normalized to the expression levels are also shown. Wild-type UGT1A1 catalyzed SN-38 glucuronidation with an average apparent Km value of 8.67 µM, whereas P229L catalyzed SN-38 glucuronidation with a Km value of 37.6 µM. The average Vmax values were 71.2 and 5.27 pmol/min/mg membrane protein for the wild-type and P229L, respectively. The average intrinsic clearances of SN-38 by glucuronidation (Vmax/Km) normalized to expressed UGT1A1 protein levels were 8.26 and 0.24 µl/min/mg protein for the wild-type and P229L, respectively.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. Representative Michaelis-Menten kinetics of SN-38 glucuronidation by expressed wild-type ({bullet}) and variant P229L ({circ}) UGT1A1 in COS-1 cells. SN-38 glucuronidation by expressed UGT1A1 was assayed in the presence of the membrane fractions (100 µg) at substrate concentrations ranging from 2.5 to 150 µM. The solid line indicates predicted glucuronidation using Michaelis-Menten kinetic parameters estimated by nonlinear regression analysis.

 

View this table:
[in this window]
[in a new window]
 
TABLE 4 Kinetic parameters of SN-38 glucuronidation by wild-type and P229L UGT1A1

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
There have been previous reports of the allele frequencies of variants in the TATA box in various ethnic groups (Beutler et al., 1998Go; Fertrin et al., 2002Go; Innocenti et al., 2002Go; Sugatani et al., 2002Go; Ki et al., 2003Go; Premawardhena et al., 2003Go; Sai et al., 2004Go). According to these studies, allele frequencies of the wild-type TA6 were highest in Polynesian people (0.97–0.99), followed by Asians, including Japanese, Koreans, and Taiwanese (0.81–0.92), and Caucasians (0.61–0.73). Allele frequencies were lowest in Africans (0.44–0.52). The allele frequencies of TA5 and TA8 in Africans were reported as approximately 0.05, but were very rare in Caucasians and were not detected in Asians. The allele frequencies of the four genotypes in the TATA box in African-American, Caucasian, and Japanese populations observed in this study were in the ranges previously reported. Allele frequencies of other UGT1A1 variations have not been as extensively studied as those in the TATA box. The allele frequencies for the variant –3279T>G were 0.17 to 0.27 in Japanese and Koreans (Sugatani et al., 2002Go; Ki et al., 2003Go; Sai et al., 2004Go), 0.47 in Caucasians (Innocenti et al., 2002Go), and 0.85 in African-Americans (Innocenti et al., 2002Go). Thus, our data (0.257 for Japanese, 0.550 for Caucasians, and 0.847 for African-Americans) are comparable with previously reported frequencies of this allele. The allele frequency of the variant 211G>A observed in this study was comparable to previously reported values for Asian people (0.09–0.21) (Huang et al., 2000Go; Sugatani et al., 2002Go; Ki et al., 2003Go; Sai et al., 2004Go). The variant is considered to be characteristic for Asians. We found only two individuals with this allele out of 150 Caucasians, and no African-Americans had this allele.

Innocenti et al. (2002Go) reported on the haplotype frequencies of UGT1A1 in African-Americans and Caucasians using –3279T>G, the TA repeat, and other SNPs in the transcription-regulating region. Although they did not use the marker SNPs 211G>A and 686C>A (likely due to their rarity in both populations), frequencies of the *28, *36, *37, and *60 haplotype groups in African-Americans can be calculated according to their data as 0.35, 0.04, 0.12, and 0.33, and the calculated frequencies in Caucasian as 0.36, 0.01, 0.01, and 0.09. These frequencies were also comparable to our data. We found two individuals carrying 211G>A in the Caucasian group; however, we could not infer haplotypes for these individuals with high certainty. The observed haplotype *28 group frequency in our study of 0.100 (*28b plus *28c) was slightly lower than the reported values of 0.131 in Japanese patients (Sai et al., 2004Go) and 0.127 in Koreans (Ki et al., 2003Go). However, the previously reported values are included in the 95% confidence interval of our data. The observed haplotype *6 group frequency (*6a plus *6b) was also comparable to the previously reported data in Japanese and Koreans. A strong association of TA7 with –3279G was suggested for Japanese cancer patients (Sai et al., 2004Go). This association was also observed in all populations measured in this study. Other variations, TA5 and TA8 in the TATA box, also had linkage with –3279G.

Recent studies indicate that 3'-untranslated regions may regulate mRNA stability (Day and Tuite, 1998Go; Conne et al., 2000Go). Exon 1 is unique for each member of the UGT1A subfamily, whereas exons 2 to 5 are common to all members of the subfamily. The variants in the 3'-untranslated region of UGT1A1 in exon 5, therefore, could have various effects on all enzymes of the UGT1A subfamily. However, until recently, their physiological effects have remained unknown. Acuna et al. (2003) reported a protective effect of the variant 1941C>G on liver transaminase levels caused by tolcapone, for which glucuronidation (mainly by UGT1A9) is one metabolic pathway (Acuna et al., 2003). The SNP 1941C>G is a marker for haplotype *IB in block 2 as shown in Table 3. Sai et al. (2004Go) reported the *IB-dependent decreasing trend of the AUC ratio (SN-38G/SN-38) and an increase in serum total bilirubin levels. Highly differential haplotype distributions in both blocks 1 and 2 observed in different ethnic groups may cause different toxicity profiles during therapy using drugs, such as CPT-11, that are metabolized by UGT1A1.

A novel SNP 686C>T was found in an African-American sample in this study, leading to an amino acid change, P229L, which is different from the known SNP 686C>A (P229Q). Studies using a larger sample size may be necessary to elucidate an accurate frequency. The known SNP 686C>A (P229Q) was reported to be related to Gilbert's syndrome and to have very low bilirubin glucuronidation activity (Koiwai et al., 1995Go). However, Jinno et al. (2003aGo,bGo) reported that protein expression and mRNA levels of P229Q expressed in COS-1 cells were comparable to those of the wild type, and the decrease in its SN-38 glucuronidation was marginal. Since the association of P229Q with TA7 has been suggested previously (Huang et al., 2000Go; Sai et al., 2004Go) and confirmed in this study, hyperbilirubinemia observed in Japanese and Taiwanese patients carrying the P229Q variant can be mainly attributed to the TA7 variation. On the other hand, the novel variant P229L expressed in COS-1 cells was found to have extremely low SN-38 glucuronidation efficacy in this study (less than 3% of that for the wild type). The low glucuronidation activity of P229L was not caused by its low transcription levels, because a significant difference in the mRNA level was not observed between the wild type and variant. The low UGT1A1/P229L expression level in COS-1 cells suggests that this enzyme is unstable compared with the wild-type enzyme. Moreover, a band shifted to a higher molecular weight than the wild-type UGT1A1 was detected by a rabbit anti-human UGT1A antibody in a Western blot. Such additional bands were also observed in Western blots of variant UGT1A1 having extremely low enzyme activities, such as F83L and Y486D in our group (Jinno et al., in press). The band shift to a higher molecular weight in SDS-polyacrylamide gel electrophoresis is considered to be the result of products with different post-translational modifications such as phosphorylation or glycosylation, which may occur due to conformational changes caused by amino acid substitution. This may also contribute to the extremely low catalytic activity of the variant enzyme compared with that of the wild type as shown in Table 4. Although the clinical significance of 229L remains to be confirmed, this novel SNP may be a potential cause of diseases such as hyperbilirubinemia or jaundice and may cause severe adverse effects after administration of CPT-11.


    Acknowledgments
 
We thank Professor Ichiro Ieiri from Tottori University Hospital for extracting the genomic DNA. We also thank Yakult Honsha Co. Ltd. for kindly providing the SN-38 and SN-38G.


    Footnotes
 
This study was supported in part by the program for the Promotion of Studies in Health Sciences of the Ministry of Health, Labor and Welfare and the program for the Promotion of Fundamental Studies in Health Sciences of the Pharmaceuticals and Medical Devices Agency of Japan.

Article, publication date, and citation information can be found at http://dmd.aspetjournals.org.

doi:10.1124/dmd.104.001800.

ABBREVIATIONS: SN-38, 7-ethyl-10-hydroxycamptothecin; CPT-11, 7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin; SN-38G, 7-ethyl-10-hydroxycamptothecin glucuronide; CN, Crigler-Najjar; SNP, single nucleotide polymorphism; PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction.

Address correspondence to: Dr. Nahoko Kaniwa, Division of Medicinal Safety Science, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501, Japan. E-mail: nkaniwa{at}nihs.go.jp


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 


Acuna G, Foernzler D, Leong D, Rabbia M, Smit R, Dorflinger E, Gasser R, Hoh J, Ott J, Borroni E, et al. (2002) Pharmacogenetic analysis of adverse drug effect reveals genetic variant for susceptibility to liver toxicity. Pharmacogenomics J 2: 327–334.[CrossRef][Medline]

Ando Y, Saka H, Ando M, Sawa T, Muro K, Ueoka H, Yokoyama A, Saitoh S, Shimokata K, and Hasegawa Y (2000) Polymorphisms of UDP-glucuronosyltransferase gene and irinotecan toxicity: a pharmacogenetic analysis. Cancer Res 60: 6921–6926.[Abstract/Free Full Text]

Araki E, Ishikawa M, Iigo M, Koide T, Itabashi M, and Hoshi A (1993) Relationship between development of diarrhea and the concentration of SN-38, an active metabolite of CPT-11, in the intestine and the blood plasma of athymic mice following intraperitoneal administration of CPT-11. Jpn J Cancer Res 84: 697–702.[CrossRef][Medline]

Beutler E, Gelbart T, and Demina A (1998) Racial variability in the UDP-glucuronosyltransferase 1 (UGT1A1) promoter: a balanced polymorphism for regulation of bilirubin metabolism? Proc Natl Acad Sci USA 95: 8170–8174.[Abstract/Free Full Text]

Bosma PJ, Chowdhury JR, Bakker C, Gantla S, de Boer A, Oostra BA, Lindhout D, Tytgat GN, Jansen PL, Oude Elferink RP, et al. (1995) The genetic basis of the reduced expression of bilirubin UDP-glucuronosyltransferase 1 in Gilbert's syndrome. N Engl J Med 333: 1171–1175.[Abstract/Free Full Text]

Burchell B, Soars M, Monaghan G, Cassidy A, Smith D, and Ethell B (2000) Drug-mediated toxicity caused by genetic deficiency of UDP-glucuronosyltransferases. Toxicol Lett 112–113: 333–340.[CrossRef]

Conne B, Stutz A, and Vassalli JD (2000) The 3' untranslated region of messenger RNA: a molecular "hotspot" for pathology? Nat Med 6: 637–641.[CrossRef][Medline]

Day DA and Tuite MF (1998) Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview. J Endocrinol 157: 361–371.[Abstract]

Fertrin KY, Goncalves MS, Saad ST, and Costa FF (2002) Frequencies of UDP-glucuronosyltransferase 1 (UGT1A1) gene promoter polymorphisms among distinct ethnic groups from Brazil. Am J Med Genet 108: 117–119.[CrossRef][Medline]

Hanioka N, Ozawa S, Jinno H, Ando M, Saito Y, and Sawada J (2001) Human liver UDP-glucuronosyltransferase isoforms involved in the glucuronidation of 7-ethyl-10-hydroxycamptothecin. Xenobiotica 31: 687–699.[CrossRef][Medline]

Huang CS, Luo GA, Huang ML, Yu SC, and Yang SS (2000) Variations of the bilirubin uridine-diphosphoglucuronosyl transferase 1A1 gene in healthy Taiwanese. 10: 539–544.

Innocenti F, Grimsley C, Das S, Ramirez J, Cheng C, Kuttab-Boulos H, Ratain MJ, and Di Rienzo A (2002) Haplotype structure of the UDP-glucuronosyltransferase 1A1 promoter in different ethnic groups. Pharmacogenetics 12: 725–733.[CrossRef][Medline]

Iolascon A, Faienza MF, Centra M, Storelli S, Zelante L, and Savoia A (1999) TA8 allele in the UGT1A1 gene promoter of a Caucasian with Gilbert's syndrome. Haematologica 84: 106–109.[Abstract/Free Full Text]

Iyer L, Das S, Janisch L, Wen M, Ramirez J, Karrison T, Fleming GF, Vokes EE, Schilsky RL, and Ratain MJ (2002) UGT1A1*28 polymorphism as a determinant of irinotecan disposition and toxicity. Pharmacogenomics J 2: 43–47.[CrossRef][Medline]

Iyer L, Hall D, Das S, Mortell MA, Ramirez J, Kim S, Di Rienzo A, and Ratain MJ (1999) Phenotype-genotype correlation of in vitro SN-38 (active metabolite of irinotecan) and bilirubin glucuronidation in human liver tissue with UGT1A1 promoter polymorphism. Clin Pharmacol Ther 65: 576–582.[CrossRef][Medline]

Iyer L, King CD, Whitington PF, Green MD, Roy SK, Tephly TR, Coffman BL, and Ratain MJ (1998) Genetic predisposition to the metabolism of irinotecan (CPT-11). Role of uridine diphosphate glucuronosyltransferase isoform 1A1 in the glucuronidation of its active metabolite (SN-38) in human liver microsomes. J Clin Investig 101: 847–854.[Medline]

Jinno H, Hanioka N, Tanaka-Kagawa T, Saito Y, Ozawa S, and Sawada J (2005) Transfection assays with allele specific constructs: functional analysis of UDP-glucuronosyltransferase variants, in Methods in Molecular Biology, Vol. 311: Pharmacogenomics: Methods and Applications (Innocenti F ed), Humana Press Inc., Totowa, NJ, in press.

Jinno H, Saeki M, Saito Y, Tanaka-Kagawa T, Hanioka N, Sai K, Kaniwa N, Ando M, Shirao K, Minami H, et al. (2003a) Functional characterization of human UDP-glucuronosyltransferase 1A9 variant, D256N, found in Japanese cancer patients. J Pharmacol Exp Ther 306: 688–693.[Abstract/Free Full Text]

Jinno H, Tanaka-Kagawa T, Hanioka N, Saeki M, Ishida S, Nishimura T, Ando M, Saito Y, Ozawa S, and Sawada J (2003b) Glucuronidation of 7-ethyl-10-hydroxycamptothecin (SN-38), an active metabolite of irinotecan (CPT-11), by human UGT1A1 variants, G71R, P229Q, and Y486D. Drug Metab Dispos 31: 108–113.[Abstract/Free Full Text]

Judson R, Stephens JC, and Windemuth A (2000) The predictive power of haplotypes in clinical response. Pharmacogenomics 1: 15–26.[CrossRef][Medline]

Ki CS, Lee KA, Lee SY, Kim HJ, Cho SS, Park JH, Cho S, Sohn KM, and Kim JW (2003) Haplotype structure of the UDP-glucuronosyltransferase 1A1 (UGT1A1) gene and its relationship to serum total bilirubin concentration in a male Korean population. Clin Chem 49: 2078–2081.[Free Full Text]

Koiwai O, Nishizawa M, Hasada K, Aono S, Adachi Y, Mamiya N, and Sato H (1995) Gilbert's syndrome is caused by a heterozygous missense mutation in the gene for bilirubin UDP-glucuronosyltransferase. Hum Mol Genet 4: 1183–1186.[Abstract/Free Full Text]

Kraemer D and Klinker H (2002) Crigler-Najjar syndrome type II in a Caucasian patient resulting from two mutations in the bilirubin uridine 5'-diphosphate-glucuronosyltransferase (UGT1A1) gene. J Hepatol 36: 706–707.[CrossRef][Medline]

Mackenzie PI, Owens IS, Burchell B, Bock KW, Bairoch A, Belanger A, Fournel-Gigleux S, Green M, Hum DW, et al. (1997) The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics 7: 255–269.[Medline]

Premawardhena A, Fisher CA, Liu YT, Verma IC, de Silva S, Arambepola M, Clegg JB, and Weatherall DJ (2003) The global distribution of length polymorphisms of the promoters of the glucuronosyltransferase 1 gene (UGT1A1): hematologic and evolutionary implications. Blood Cells Mol Dis 31: 98–101.[CrossRef][Medline]

Raijmakers MT, Jansen PL, Steegers EA, and Peters WH (2000) Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene. J Hepatol 33: 348–351.[CrossRef][Medline]

Saeki M, Ozawa S, Saito Y, Jinno H, Hamaguchi T, Nokihara H, Shimada Y, Kunitoh H, Yamamoto N, Ohe Y, et al. (2002) Three novel single nucleotide polymorphisms in UGT1A10. Drug Metab Pharmacokinet 17: 488–490.

Saeki M, Saito Y, Jinno H, Tohkin M, Kurose K, Kaniwa N, Komamura K, Ueno K, Kamakura S, Kitakaze M, et al. (2003) Comprehensive UGT1A1 genotyping in a Japanese population by pyrosequencing. Clin Chem 49: 1182–1185.[Free Full Text]

Sai K, Saeki M, Saito Y, Ozawa S, Katori N, Jinno H, Hasegawa R, Kaniwa N, Sawada J, Komamura K, et al. (2004) UGT1A1 haplotypes associated with reduced glucuronidation and increased serum bilirubin in irinotecan-administered Japanese patients with cancer. Clin Pharmacol Ther 75: 501–515.[CrossRef][Medline]

Stephens M and Donnelly P (2003) A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet 73: 1162–1169.[CrossRef][Medline]

Stephens M, Smith NJ, and Donnelly P (2001) A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 68: 978–989.[CrossRef][Medline]

Sugatani J, Yamakawa K, Yoshinari K, Machida T, Takagi H, Mori M, Kakizaki S, Sueyoshi T, Negishi M, and Miwa M (2002) Identification of a defect in the UGT1A1 gene promoter and its association with hyperbilirubinemia. Biochem Biophys Res Commun 292: 492–497.[CrossRef][Medline]

Tukey RH and Strassburg CP (2000) Human UDP-glucuronosyltransferases: metabolism, expression and disease. Annu Rev Pharmacol Toxicol 40: 581–616.[CrossRef][Medline]

Yamamoto A, Nishio H, Waku S, Yokoyama N, Yonetani M, Uetani Y, and Nakamura H (2002) Gly71Arg mutation of the bilirubin UDP-glucuronosyltransferase 1A1 gene is associated with neonatal hyperbilirubinemia in the Japanese population. Kobe J Med Sci 48: 73–77.[Medline]


This article has been cited by other articles:


Home page
BloodHome page
V. Ribrag, S. Koscielny, O. Casasnovas, C. Cazeneuve, P. Brice, F. Morschhauser, J. Gabarre, A. Stamatoullas, G. Lenoir, G. Salles, et al.
Pharmacogenetic study in Hodgkin lymphomas reveals the impact of UGT1A1 polymorphisms on patient prognosis
Blood, April 2, 2009; 113(14): 3307 - 3313.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
A. L. Hong, D. Huo, H.-J. Kim, Q. Niu, D. L. Fackenthal, S. A. Cummings, E. M. John, D. W. West, A. S. Whittemore, S. Das, et al.
UDP-Glucuronosyltransferase 1A1 Gene Polymorphisms and Total Bilirubin Levels in an Ethnically Diverse Cohort of Women
Drug Metab. Dispos., August 1, 2007; 35(8): 1254 - 1261.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. Saeki, Y. Saito, K. Sai, K. Maekawa, N. Kaniwa, J.-i. Sawada, M. Kawamoto, A. Saito, and N. Kamatani
A Combinatorial Haplotype of the UDP-Glucuronosyltransferase 1A1 Gene (#60-#IB) Increases Total Bilirubin Concentrations in Japanese Volunteers
Clin. Chem., February 1, 2007; 53(2): 356 - 358.
[Full Text] [PDF]


Home page
NEJMHome page
N. Risch
Dissecting Racial and Ethnic Differences
N. Engl. J. Med., January 26, 2006; 354(4): 408 - 411.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
W. Sadee and Z. Dai
Pharmacogenetics/genomics and personalized medicine
Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R207 - R214.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dmd.104.001800v1
33/3/458    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaniwa, N.
Right arrow Articles by Hasegawa, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaniwa, N.
Right arrow Articles by Hasegawa, R.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition