DMD

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Drug Metabolism and Disposition Fast Forward
First published on March 10, 2006; DOI: 10.1124/dmd.105.007997


0090-9556/06/3406-950-954$20.00
DMD 34:950-954, 2006

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dmd.105.007997v1
34/6/950    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimizu, T.
Right arrow Articles by Chiba, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimizu, T.
Right arrow Articles by Chiba, K.

AUTOINDUCTION OF MKC-963 [(R)-1-(1-CYCLOHEXYLETHYLAMINO)-4-PHENYLPHTHALAZINE] METABOLISM IN HEALTHY VOLUNTEERS AND ITS RETROSPECTIVE EVALUATION USING PRIMARY HUMAN HEPATOCYTES AND CDNA-EXPRESSED ENZYMES

Toshiyuki Shimizu, Kei Akimoto, Takuya Yoshimura, Takuro Niwa, Kaoru Kobayashi, Michio Tsunoo, and Kan Chiba

Pharmacokinetics Laboratory, Mitsubishi Pharma Corporation, Chiba, Kisarazu-shi, Japan (T.S., K.A., T.Y. and T.N.); Hohsen Clinic, Research Center for Clinical Pharmacology, The Kitasato Institute, Tokyo, Japan (M.T.); and Laboratory of Pharmacology and Toxicology, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba, Japan (T.S., K.K. and K.C.)

(Received October 25, 2005; accepted March 3, 2006)


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
MKC-963, (R)-1-(1-cyclohexylethylamino)-4-phenylphthalazine, a potent inhibitor of platelet aggregation, was synthesized and used in clinical trials in the 1990s. In the process of clinical study, it was found that urinary excretion ratios for 6ß-hydroxycortisol and free cortisol increased significantly in parallel with decreases in the plasma concentrations of MKC-963 after repeated oral administration of the compound to healthy volunteers. These findings suggested that MKC-963 caused autoinduction (defined as the ability of a drug to induce enzymes that enhance its own metabolism, resulting in dispositional tolerance) in humans, and clinical studies using the compound were stopped. This experience prompted us to reevaluate the effects of this compound on CYP3A4 using primary human hepatocytes and cDNA-expressed human cytochrome P450 (P450) enzymes to determine whether the autoinduction of MKC-963 metabolism in humans could have been predicted if these in vitro systems had been used for the evaluation of MKC-963 in the preclinical study. The results of in vitro study showed that MKC-963 increased CYP3A4 mRNA expression level and activity of testosterone 6ß-hydroxylation to extents similar to those observed with rifampicin in primary human hepatocytes. In addition, approximately 90% of the MKC-963 metabolism in human liver microsomes was estimated to be attributable to CYP3A4. These in vitro findings are in good agreement with the results of clinical study, suggesting that studies using human hepatocytes and cDNA-expressed human P450s are useful for assessing the autoinductive nature of compounds under development before starting clinical studies.


MKC-963, (R)-1-(1-cyclohexylethylamino)-4-phenylphthalazine (Fig. 1), a potent inhibitor of platelet aggregation, was synthesized and used in clinical trials by Mitsubishi Chemical Corp. (Tokyo, Japan) in the 1990s. In the process of clinical trials, the urinary excretion of 6ß-hydroxycortisol (6ß-OHF) and free cortisol (F) was studied after repeated oral administration of MKC-963 in human volunteers to determine whether this compound induces CYP3A4 or not. This was because the compound would be used for treatment of circulatory disorders together with drugs such as antihypertensives, antihyperlipidemics or antidiabetes. Many of these drugs are metabolized by CYP3A4 (Li et al., 1995Go; Lehmann et al., 1998Go; Prueksaritanont et al., 2003Go; Jerling et al., 2005Go), a predominant P450 enzyme found in the adult human liver that catalyzes the oxidation of a wide variety of exogenous compounds (Guengerich et al., 1986Go). In addition, CYP3A4 had been reported to be induced by several drugs, including rifampicin, phenytoin, and phenobarbital, that caused clinical drug-drug interactions (Holtbecker et al., 1996Go; Anderson 1998Go; Ridtitid et al., 2002Go). Moreover, measurement of the urinary ratio of 6ß-OHF and F (6ß-OHF/F) had been regarded as a safe and simple method for evaluating induction of CYP3A4 because it is noninvasive and does not require administration of a probe drug to volunteers (Galteau and Shamsa, 2003Go).


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. Chemical structure of MKC-963.

 
In this clinical study on MKC-963, we found that 6ß-OHF/F increased significantly in parallel with decreases in the plasma concentrations of MKC-963 after repeated oral administration of the compound to healthy volunteers. This finding suggested that CYP3A4 is induced by MKC-963 and that the compound itself is an autoinducer in humans. Because autoinduction1 was thought to reduce the therapeutic response of MKC-963 and might cause clinical problems, the clinical study on MKC-963 was abandoned at that time. Thus, we have recently decided to reevaluate the effects of this compound on CYP3A4 using primary human hepatocytes and cDNA-expressing human P450 enzymes to determine whether we could have predicted the autoinduction of MKC-963 metabolism if we had used these in vitro systems for the preclinical evaluation of MKC-963.

In this paper, we describe the results of the clinical study on the pharmacokinetics of MKC-963 and its effects on the urinary excretion ratio of 6ß-OHF and F after repeated oral administration of the compound to healthy volunteers, and the results of in vitro studies on the effects of MKC-963 on the expression and activities of CYP3A4 and identification of the P450 enzyme(s) responsible for the metabolism of MKC-963 using primary human hepatocytes and cDNA-expressed human P450 enzymes, respectively. The results suggest that these in vitro systems would have been useful for the prediction of the autoinductive nature of MKC-963 in the preclinical study.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Materials. MKC-963 was provided by Mitsubishi Chemical Corp. (Tokyo, Japan), and its chemical purity was 99.8%. Rifampicin, testosterone and 6ß-hydroxytestosterone were purchased from Sigma-Aldrich (St. Louis, MO), Tokyo Kasei Kogyo Co. (Tokyo, Japan), and Sumika Chemical Analysis Service, Ltd. (Osaka, Japan), respectively. All other chemicals were of analytical reagent grade.

In Vivo Study. Subjects. Six healthy male volunteers aged between 20 and 35 years were recruited for the study. They were within ±20% of their ideal body weight and in good general health according to routine medical history and laboratory data. They did not use any medications for at least 2 weeks before and were not using any concurrent medications during the study. All of them agreed to refrain from consumption of alcohol and grapefruit or grape-fruit juice during the study. Subjects who had clinically significant abnormalities on preliminary examination, those who had a history of drug or food allergies or a history of drug or alcohol abuse, and those who had donated blood or received an investigational drug within 4 months before the start of this study were excluded from this study.

Study Protocol. The subjects received a single oral dose of MKC-963 on day 1 and on day 14, and two oral doses per day with a 12-h interval for 12 days (from day 2 to day 13). Each dose was 120 mg, and the drug was supplied as tablets (40 mg). The oral doses were administered with 100 ml of water at 9:00 AM after breakfast or at 9:00 PM after dinner. Breakfast and dinner were standardized for all the subjects. Blood samples (each 4 ml) were collected by venipuncture at 0, 0.25, 0.5, 1, 1.5, 2, 3, 4, 6, and 8 h after the first administration of MKC-963 on days 1 and 14 and at 0, 1, and 2 h on days 2, 5, 8, and 11. The blood samples collected were centrifuged at 1500g for 10 min at 4°C, and plasma samples were separated and stored at -20°C until analyses. Urine samples were pooled over a period of 24 h and collected at the end of designated days: the day before and 1, 2, 5, 8, 11, and 14 days after starting drug administration. The urine was kept cool during collection, and then the total volume was recorded and a 10-ml aliquot was stored at -20°C until analyses.

The study was conducted at Hohsen Clinic, Research Center for Clinical Pharmacology, The Kitasato Institute (Tokyo, Japan), and the protocol was approved by the institutional review board. The study was conducted in accordance with the guidelines on good clinical practice and the ethical standards for human experimentation established by the Declaration of Helsinki. Each subject gave written informed consent.

Determination of MKC-963 Concentrations in Plasma. Plasma concentrations of MKC-963 were determined by liquid chromatography-tandem mass spectrometry. d5MKC-963 was used as an internal standard. The plasma (0.5 ml) was mixed with 0.4 ml of Titrisol buffer (pH 9) and applied on a solid-phase extraction column (Extrelut-1; Merck KGaA, Darmstadt, Germany). The MKC-963 and internal standard were isolated from the column with 5 ml of diethyl ether. The organic extract was dried under nitrogen and reconstituted in 1 ml of acetonitrile. The sample was separated by a Waters HPLC system (Waters, Milford, MA) equipped with a Capcell Pak CN column (5 µm, 35 x 4.6 mm in internal diameter; Shiseido, Tokyo, Japan). The mobile phase consisted of acetonitrile/water/acetic acid (90:10:1, v/v/v) and the flow rate was maintained at 0.2 ml/min. MKC-963 and the internal standard were detected by tandem mass spectrometry using a Finnigan TSQ7000 mass spectrometer (Thermo Electron Corp., Waltham, MA). For mass spectral detection, the following precursors to product ion reactions were monitored: m/z 332.1 > m/z 222.1 for MKC-963 and m/z 337.0 > m/z 227.1 for d5MKC-963. The standard curves were linear from 0.1 ng/ml to 50 ng/ml. The interassay precision (% CV) assessed from the blank plasma to which known concentrations of the analytes was added (final concentrations of 0.1 ng/ml to 50 ng/ml) ranged from 2.0% to 7.7%. The limit of sensitivity of the assay was 0.01 ng/ml.

Pharmacokinetic Parameters. The pharmacokinetic parameters of MKC-963 were estimated by noncompartmental methods with the use of WinNonlin V4.1 (Pharsight Corporation, Mountain View, CA). The values of Cmax and tmax were determined directly from the plasma concentration-time profiles. The area under the plasma concentration-time curve (AUC) from 0 to 24 h was determined by the linear trapezoidal rule from the beginning of drug administration to the last quantifiable data point. The value of t1/2 was calculated by linear regression analysis of the last elimination phase after log transformation of the data.

Determination of Urinary 6ß-OHF and F. Determination of 6ß-OHF and F in urine samples was performed by using enzyme immunoassay kits for urinary 6ß-OHF (Stabiligen, Villers-Les-Nancy, France) and F (Biométreux, Marcy l'Etoile, France), respectively, according to the manufacturer's instructions. The cross-reactivity of these kits for urinary F and 6ß-OHF were 4.4 and 1.1%, respectively.

In Vitro Study. Human Primary Hepatocytes and Treatment with MKC-963. Cryopreserved human hepatocytes (lot 100, white female, 74 years old) were obtained from In Vitro Technologies, Inc. (Baltimore, MD). Hepatocytes were suspended in Hepatocyte Culture Medium (Cambrex, Walkersville, MD), centrifuged at 50g for 3 min, and resuspended in the same medium. The cells were plated onto Matrigel-coated 24-well plates at a density of 1.5 x 105 cells/well and were maintained in an atmosphere of 95% air and 5% CO2 at 37°C. The cell viability was more than 80% assessed by a trypan blue exclusion test. Stock solutions of MKC-963 and rifampicin were prepared in dimethyl sulfoxide and were diluted before each use. Treatments of hepatocytes with chemicals were begun on the fourth day after seeding and continued for 4 days. The hepatocytes were treated with dimethyl sulfoxide (final concentration of 0.2%), rifampicin (10 µM), a positive control, or MKC-963 (0.25 µM). The concentration of MKC-963 used in the present study was determined considering that Cmax of MKC-963 was 0.29 µM when 120 mg of MKC-963 was administered orally to human volunteers (Fig. 2). The concentration of rifampicin used in the present study also corresponded nearly to Cmax of rifampicin after an oral administration of 450 to 600 mg in patients with tuberculosis (Smith, 2000Go).


Figure 2
View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. Plasma concentration-time profiles of MKC-963 on day 1 (open circles) and day 14 (closed circles) after oral administration of 120 mg to six healthy subjects. Data are expressed as means ± S.D. *, p < 0.05; **, p < 0.01.

 
RNA Extraction and Real-Time PCR. Total RNA was extracted using TRIzol reagent (Invitrogen Corp., Carlsbad, CA) according to the manufacturer's instructions. All samples were stored at -80°C until used for cDNA preparation. One microgram of total RNA was reverse-transcribed into cDNA with random hexamers using a SuperScript II Transcription system (Invitrogen Corp) according to the manufacturer's instructions. The expression levels of specific mRNAs were determined by using a quantitative real-time PCR method. The primer and TaqMan minor groove binder (MGB) probe sets were designed by using Primer Express software (Applied Biosystems, Foster City, CA). The sequences (5' to 3') for the primers and probes are as follows: CYP3A4, forward primer (GCAGGAGGAAATTGATGCAGTT), TaqMan MGB probe [FAM (Applied Biosystems)-ATAAGGCACCACCCACCTA-MGB], and reverse primer (CTGAGCGTTTCATTCACCACC); ß-actin, forward primer (CCTGGCACCCAGCACAAT), fluorogenic probe [VIC (Applied Biosystems)-ATCATTGCTCCTCCTGAG-MGB], and reverse primer (CCGATCCACACGGAGTACTTG). The sequence of fluorogenic probe for CYP3A4 was one base different from that of CYP3A5, which is recognized by MGB-probe according to the supplier's manuals. Cycling conditions of the PRISM 7900 Sequence Detection system (Applied Biosystems) were 50°C for 2 min and 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. CYP3A4 mRNA levels in cultured human hepatocytes were expressed as ratio against ß-actin mRNA levels.

Determination of CYP3A4 Activities in Human Hepatocyte Culture. CYP3A4 activities were determined by the measurement of 6ß-hydroxylation activities for testosterone in intact hepatocytes cultured on 24-well plates (Donato et al., 1995Go). After treatment with chemicals, monolayers were incubated with testosterone (250 µM) for 30 min. Quantification of 6ß-hydroxytestosterone was performed by high-performance liquid chromatography (Donato et al., 1993Go).

Identification of P450 Enzyme(s) Contributing to the Metabolism of MKC-963. Recombinant P450 enzymes expressed in insect cells infected with baculovirus containing human P450 and human NADPH-P450 reductase cDNA inserts were obtained from BD Gentest (Woburn, MA). Incubation mixtures contained cDNA-expressed P450s (50 pmol/ml) in potassium phosphate buffer (pH 7.4), an NADPH-generating system, and MKC-963. Substrate (2 µM MKC-963) was incubated at 37°C for 0, 5, 15, and 30 min with microsomes expressing CYP1A2, CYP2C9, CYP2C19, CYP2D6, or CYP3A4, and determined by liquid chromatography/mass spectrometry. The remaining percentage of MKC-963 was calculated using the t = 0 value as 100%. Then, in vitro clearance of each P450 enzyme (CL) was estimated from the following equation: CL (µl/min/pmol P450) =-slope (1/min)/P450 concentration (pmol P450/ml) x 1000, where slope was determined from linear regression analysis between log percentage of MKC-963 and incubation time (Obach, 1999Go), and P450 concentration was the concentration of recombinant P450 enzyme in the incubation mixture. CL was corrected with the P450 contents in native human liver microsomes (Rodrigues, 1999Go) as follows: Corrected CL = CL x enzyme content of each P450. Therefore, the contribution of each P450 enzyme to overall clearance was estimated from the following equation: Contribution of each P450 enzyme (%) = corrected CL for each P450 enzyme/sum of corrected CL x 100.

Statistics. Statistical analysis was performed with SAS software (version 8.2; SAS Institute, Cary, NC). A P value of <0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In Vivo Study. Pharmacokinetics of MKC-963. Plasma concentration-time profiles of MKC-963 showed a dramatic change after repeated oral administration of the compound (120 mg) to healthy subjects. As shown in Fig. 2, the mean (±S.D.) plasma concentrations of MKC-963 on day 14 at 1 to 8 h after administration were significantly lower than those on day 1. As a result, Cmax and AUC values on day 14 had decreased by 77% and 69%, respectively, compared with the values on day 1 (Table 1). There were no notable differences between tmax and t1/2 values on day 1 and those on day 14 (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Pharmacokinetic parameters of MKC-963 on day 1 and day 14 after repeated oral administration of 120 mg to six healthy subjects Data are expressed as means ± S.D. except for tmax data, which are given as median with range.

 

Figure 3 shows the changes in mean plasma concentrations of MKC-963 at 1 and 2 h after administration from day 1 to day 14. As shown in this figure, the plasma concentrations of MKC-963 at 1 h decreased significantly (p < 0.05) from day 2 to day 14, and those at 2 h also showed significant (p < 0.05) decreases from day 5 to day 14.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Plasma concentrations of MKC-963 at 1 h and 2 h after oral administration of the compound (120 mg) to six healthy subjects on days 1, 2, 5, 8, 11, and 14. Data are expressed as means ± S.D. *, p < 0.05.

 


Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
FIG. 4. Twenty-four-hour urinary excretion ratios of 6ß-hydroxycortisol and free cortisol in six healthy subjects on the day before the start of administration and on days 1, 2, 5, 8, 11, and 14. Results are expressed as means ± S.D. **, p < 0.01.

 
Urinary 6ß-OHF/F. Figure 4 shows the mean 24-h urinary excretion ratios of 6ß-OHF and F on the day before the start of administration and from day 1 to day 14. The mean value of 6ß-OHF/F increased significantly (p < 0.05) from day 2 to day 14 compared with the value on the day before the start of administration, and all subjects showed increases in the urinary excretion ratios of 6ß-OHF from day 2 to day 14.

In Vitro Study. Primary Human Hepatocytes. The effects of MKC-963 (0.25 µM) on the expression of CYP3A4 mRNA and on the activity for testosterone 6ß-hydroxylation were investigated using human primary hepatocytes. The effect of rifampicin (10 µM) was also investigated as a positive control. As shown in Fig. 5A, MKC-963 increased the expression level of CYP3A4 mRNA by 6-fold, comparable to the effect of rifampicin (increase of approximately 11-fold). Testosterone 6ß-hydroxylation activity was also increased by 9-fold in the presence of MKC-963, which is also comparable to the effect of rifampicin (14-fold increase, Fig. 5B).


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5. Effects of rifampicin (10 µM) and MKC-963 (0.25 µM) on CYP3A4 mRNA (A) and activity of testosterone 6ß-hydroxylation in primary human hepatocyte cultures (B). Total RNA was extracted, and CYP3A4 and ß-actin mRNA levels were measured by real-time PCR methods as described under Materials and Methods; then, CYP3A4 mRNA was normalized to ß-actin and compared with that of a vehicle control. The mean absolute ratio for the control hepatocytes was 0.051 ± 0.02 (A). For measurement of CYP3A4 activity, testosterone was incubated with intact hepatocytes and metabolite was analyzed as described under Materials and Methods; then, CYP3A4 activities were compared with those of a vehicle control. The mean activity of control hepatocytes was 2.3 ± 0.7 pmol/min/105 cells (B). Results are expressed as means ± S.D. of three experiments.

 
Identification of P450 Enzyme(s) Involved in the Metabolism of MKC-963. cDNA-expressed human P450s were used to estimate the enzyme(s) of P450 mainly responsible for the metabolism of MKC-963 in humans. As shown in Fig. 6A, MKC-963 was metabolized by CYP3A4 extensively, by 2D6 moderately, and by CYP1A2 to some extent. However, when the contribution of individual P450 enzymes to the overall metabolic clearance of MKC-963 was estimated by P450 contents in human liver microsomes, approximately 90% of the MKC-963 metabolism in human liver microsomes was estimated to be attributable to CYP3A4 (Fig. 6B).


Figure 6
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. Metabolic clearance of MKC-963 in microsomes from insect cells expressing P450 enzymes (50 pmol/ml) (A) and the contributions (percentage) of each P450 enzyme to the total clearance of MKC-963 in five P450 enzymes corrected by the P450 contents in native human liver microsomes as described under Materials and Methods (B). MKC-963 (2 µM) was incubated in the presence of CYP1A2, CYP2C9, CYP2C19, CYP2D6, or CYP3A4 for 0, 5, 15, and 30 min, at 37°C. Each value is the mean ± S.D. of triplicate assays.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The results of the in vitro study showed that MKC-963 increased CYP3A4 mRNA expression level and activity of testosterone 6ß-hydroxylation to extents similar to those observed with rifampicin in primary human hepatocytes (Fig. 5). In addition, approximately 90% of the MKC-963 metabolism in human liver microsomes was estimated to be attributable to CYP3A4 (Fig. 6B). These findings suggest that MKC-963 is a potent inducer of CYP3A4, which catalyzes the metabolism of MKC-963 itself. These in vitro findings are in good agreement with the results of the clinical study showing that the urinary excretion ratio of 6ß-OHF and F, a marker of CYP3A4 induction, increased significantly (Fig. 4) and that AUC and Cmax of MKC-963 decreased dramatically after repeated oral administration of the compound to healthy volunteers (Table 1). Therefore, these findings suggest that MKC-963 is a relatively potent autoinducer of CYP3A4 in humans. Moreover, the findings also suggest that in vitro studies using primary human hepatocytes coupled with cDNA-expressed P450 enzymes would have been useful to predict or assess the autoinductive character of MKC-963 in the preclinical study.

In the present study, we used 0.25 µM MKC-963 since Cmax of MKC-963 was 0.29 µM when 120 mg of MKC-963 was administered orally to human volunteers (Fig. 2). The concentration of rifampicin was also set at 10 µM because it is almost the same as Cmax of rifampicin after oral administration of 450 to 600 mg in patients with tuberculosis (Smith, 2000Go). At that dose, interaction of rifampicin with a number of drugs has been reported (Holtbecker et al., 1996Go; Villikka et al., 1999Go; Ridtitid et al., 2002Go). Under these conditions, the effect of MKC-963 on CYP3A4 in the primary culture of human hepatocytes was comparable to the effect of rifampicin, suggesting that MKC-963 is a potent inducer of CYP3A4, similar to rifampicin even in vivo. This assumption is supported by the in vivo observation that MKC-963 increased urinary excretion ratios of 6ß-OHF and F to an extent similar to that reported previously for rifampicin (Ohnhaus et al., 1989Go; Kovacs et al., 1998Go; Tran et al., 1999Go). Therefore, the concentration of the test compound used in the study on human hepatocytes appears to be an important factor for assessing the potential to induce CYP3A4 in vivo (Smith, 2000Go). In fact, it has been reported that thiazolidinediones, including troglitazone, pioglitazone, and rosiglitazone, showed the potential to induce CYP3A4 in human hepatocytes but that only troglitazone showed drug-drug interactions due to the induction of CYP3A4 in vivo (Sahi et al., 2003Go). Although the mechanism remains unknown, the authors speculated that the concentrations of pioglitazone and rosiglitazone do not reach concentrations sufficient to induce CYP3A4 in in vivo situations (Sahi et al., 2003Go). In a preclinical study, however, the actual concentrations of test compounds in plasma or other human organs are generally unknown. Thus, prediction of concentrations of the test compound in plasma or other human organs by animal scale-up (Mitsuhashi et al., 1990Go; Izumi et al., 1996Go) or by extrapolation of in vitro clearance obtained from human liver microsomes, human hepatocytes, or cDNA-expressed P450s to in vivo clearance in humans (Iwatsubo et al., 1997Go; Ito et al., 1998Go) appears to be essential to predict the ability of the test compound to induce P450 in in vivo situations.

Although the results of the present study clearly showed the induction of CYP3A4 after repeated oral administration of MKC-963, there were some differences in the time courses of changes in the indicators of induction. There was some delay in changes in the urinary ratio of 6ß-OHF and F (Fig. 4) compared with those of the plasma concentrations of MKC-963 at 1 h and 2 h after administration (Fig. 3). As shown in Fig. 3, the plasma concentrations of MKC-963 decreased dramatically on the second day after starting repeated oral administration of MKC-963, whereas the urinary ratios of 6ß-OHF and F did not show a remarkable change on day 2 but showed a considerable change on day 5 (Fig. 4). The reason for this difference in the time courses of these indicators is unknown, but it may be due to the difference in the involvement of intestinal CYP3A4 in the metabolism of MKC-963. CYP3A4 has been reported to be expressed in small intestinal epithelial cells (Watkins et al., 1987Go; Kolars et al., 1992Go) as well as in hepatic parenchymal cells (Guengerich et al., 1986Go; Shimada et al., 1994Go). Intestinal CYP3A4 has recently been suggested to be a major factor in determining the extent of first-pass metabolism and, hence, oral bioavailability of drugs (Hall et al., 1999Go). Because MKC-963 was administered orally in the present study, plasma concentration of MKC-963 should be affected by the induction of CYP3A4 in the small intestine. Although we do not know whether MKC-963 induces CYP3A4 in the small intestine 1 day after oral administration, Kolars et al. (1992Go) reported that rifampicin induces small intestinal CYP3A4 mRNA within 24 h. Therefore, it is conceivable that induction of intestinal CYP3A4 by MKC-963 occurred very rapidly, and reduced the bioavailability of MKC-963 and decreased its plasma concentration within 2 days after starting drug administration. In contrast, it has been reported that the formation of 6ß-OHF is primarily mediated by the liver and that intestinal metabolism plays a minor role (Galteau and Shamsa, 2003Go). Therefore, it is possible that the induction of CYP3A4 in the liver is slower than that in the small intestine and that change in the urinary excretion ratio of 6ß-OHF and F was therefore delayed compared with that of plasma concentration of MKC-963 after repeated oral administration. In support of this speculation, half-maximal changes in 6ß-OHF/F have been reported to be achieved 2 to 3 days after rifampicin administration (Ohnhaus et al., 1989Go).

It should be noted that hepatocytes used in this study were derived from one donor; therefore, CYP3A4 induction may have been less remarkable if other livers with low levels of CYP3A4 were used in the present study. In this case, it is possible that metabolism by CYP2D6 and CYP1A2 could be a predominant route, and autoinduction of MKC-963 metabolism may not be as remarkable as that observed in the present study.

Finally, CYP3A5 may also be involved in the autoinduction of MKC-963 metabolism. This is because substrate specificities of CYP3A5 and CYP3A4 are similar and overlapped (Wrighton et al., 1990Go). In addition, CYP3A5 has been reported to be induced by rifampicin in primary human hepatocytes (Zhuo et al., 2004Go). However, both the catalytic activity and specific content of CYP3A5 in the human liver or small intestine are much lower than those of CYP3A4 (Wrighton et al., 1990Go; Rodrigues, 1999Go). Furthermore, the extent of induction of CYP3A5 by rifampicin in human hepatocytes is less than that of CYP3A4 (Zhuo et al., 2004Go). In addition, primer sets of CYP3A4 used in the present study were specific for CYP3A4 and do not recognize CYP3A5. Therefore, it seems that the contribution of CYP3A5 to the autoinductive nature of MKC-963, if any, is much smaller than that of CYP3A4.

In summary, in vivo findings suggesting autoinduction of MKC-963 metabolism prompted us to reevaluate the autoinductive nature of the compound using primary human hepatocytes and cDNA-expressed human P450 enzymes. The results showed that MKC-963 increased CYP3A4 mRNA expression level and activity of testosterone 6ß-hydroxylation to extents similar to those observed with rifampicin in primary human hepatocytes. In addition, approximately 90% of the MKC-963 metabolism in human liver microsomes was estimated to be attributable to CYP3A4. These findings are in good agreement with the clinical study. Therefore, in vitro studies using human hepatocytes coupled with cDNA-expressed human P450s appear to be useful for assessing the autoinductive nature of compounds under development before starting clinical studies.


    Footnotes
 
This work was supported in part by Cooperative Study of Mitsubishi Pharma Corporation and Chiba University, a grant-in-aid from the Ministry of Health, Labor and Welfare of Japan (Research on Regulatory Science of Pharmaceutical and Medical Devices), and Research on Health Sciences focusing on Drug Innovation from The Japan Health Sciences Foundation (KH71069 and KH33309).

Article, publication date, and citation information can be found at http://dmd.aspetjournals.org.

doi:10.1124/dmd.105.007997.

ABBREVIATIONS: MKC-963, (R)-1-(1-cyclohexylethylamino)-4-phenylphthalazine; d5MKC-963, MKC-963 with 5 hydrogen substituted by deuterium in the phenyl ring; MGB, minor groove binder; AUC, area under the plasma concentration-time curve; Cmax, maximum plasma concentration; tmax, time to reach Cmax; t1/2, terminal half-life; F, cortisol; 6ß-OHF, 6ß-hydroxycortisol; P450, cytochrome P450; CL, in vitro clearance.

1 Autoinduction is defined as the ability of a drug to induce enzymes that enhance its own metabolism, resulting in dispositional tolerance. Back

Address correspondence to: Dr. Kan Chiba, Laboratory of Pharmacology and Toxicology, Graduate School of Pharmaceutical Sciences, Chiba University, Inohana 1-8-1, Chuo-ku, Chiba 260-8675, Japan. E-mail: kchiba{at}p.chiba-u.ac.jp


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 


Anderson GD (1998) A mechanistic approach to antiepileptic drug interactions. Ann Pharmacother 32: 554-563.[Abstract]

Donato MT, Castell JV, and Gómez-Lechón MJ (1995) Effect of model inducers on cytochrome P450 activities of human hepatocytes in primary culture. Drug Metab Dispos 23: 553-558.[Abstract]

Donato MT, Herrero E, Gómez-Lechón MJ, and Castell JV (1993) Inhibition of monooxygenase activities in human hepatocytes by interferons. Toxicol In Vitro 7: 481-485.[CrossRef]

Galteau MM and Shamsa F (2003) Urinary 6ß-hydroxycortisol: a validated test for evaluating drug induction or drug inhibition mediated through CYP3A in humans and in animals. Eur J Clin Pharmacol 59: 713-733.[CrossRef][Medline]

Guengerich FP, Martin MV, Beaune PH, Kremers P, Wolff T, and Waxman DJ (1986) Characterization of rat and human liver microsomal cytochrome P-450 forms involved in nifedipine oxidation, a prototype for genetic polymorphism in oxidative drug metabolism. J Biol Chem 261: 5051-5060.[Abstract/Free Full Text]

Hall SD, Thummel KE, Watkins PB, Lown KS, Benet LZ, Paine MF, Mayo RR, Turgeon DK, Bailey DG, Fontana RJ, et al. (1999) Molecular and physical mechanisms of first-pass extraction. Drug Metab Dispos 27: 161-166.[Abstract/Free Full Text]

Holtbecker N, Fromm MF, Kroemer HK, Ohnhaus EE, and Heidemann H (1996) The nifedipine-rifampin interaction: evidence for induction of gut wall metabolism. Drug Metab Dispos 24: 1121-1123.[Abstract]

Ito K, Iwatsubo T, Kanamitsu S, Ueda K, Suzuki H, and Sugiyama Y (1998) Prediction of pharmacokinetic alterations caused by drug-drug interactions: metabolic interaction in the liver. Pharmacol Rev 50: 387-412.[Abstract/Free Full Text]

Iwatsubo T, Hirota N, Ooie T, Suzuki H, Shimada N, Chiba K, Ishizaki T, Green CE, Tyson CA, and Sugiyama Y (1997) Prediction of in vivo drug metabolism in the human liver from in vitro metabolism data. Pharmacol Ther 73: 147-171.[CrossRef][Medline]

Izumi T, Enomoto S, Hosiyama K, Sasahara K, Shibukawa A, Nakagawa T, and Sugiyama Y (1996) Prediction of the human pharmacokinetics of troglitazone, a new and extensively metabolized antidiabetic agent, after oral administration, with an animal scale-up approach. J Pharmacol Exp Ther 277: 1630-1641.[Abstract/Free Full Text]

Jerling M, Huan BL, Leung K, Chu N, Abdallah H, and Hussein Z (2005) Studies to investigate the pharmacokinetic interactions between ranolazine and ketoconazole, diltiazem, or simvastatin during combined administration in healthy subjects. J Clin Pharmacol 45: 422-433.[Abstract/Free Full Text]

Kolars JC, Schmiedlin-Ren P, Schuetz JD, Fang C, and Watkins PB (1992) Identification of rifampin-inducible P450IIIA4 (CYP3A4) in human small bowel enterocytes. J Clin Investig 90: 1871-1878.[Medline]

Kovacs SJ, Martin DE, Everitt DE, Patterson SD, and Jorkasky DK (1998) Urinary excretion of 6ß-hydroxycortisol as an in vivo marker for CYP3A induction: applications and recommendations. Clin Pharmacol Ther 63: 617-622.[Medline]

Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, and Kliewer SA (1998) The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Investig 102: 1016-1023.[Medline]

Li AP, Kaminsky DL, and Rasmussen U (1995) Substrates of human hepatic cytochrome P450 3A4. Toxicology 104: 1-8.[CrossRef][Medline]

Mitsuhashi Y, Sugiyama Y, Ozawa S, Nitanai T, Sasahara K, Nakamura K, Tanaka M, Nishimura T, Inaba M, and Kobayashi T (1990) Prediction of ACNU plasma concentration-time profiles in humans by animal scale-up. Cancer Chemother Pharmacol 27: 20-26.[CrossRef][Medline]

Obach RS (1999) Prediction of human clearance of twenty-nine drugs from hepatic microsomal intrinsic clearance data: an examination of in vitro half-life approach and nonspecific binding to microsomes. Drug Metab Dispos 27: 1350-1359.[Abstract/Free Full Text]

Ohnhaus EE, Breckenridge AM, and Park BK (1989) Urinary excretion of 6ß-hydroxycortisol and the time course measurement of enzyme induction in man. Eur J Clin Pharmacol 36: 39-46.[CrossRef][Medline]

Prueksaritanont T, Ma B, and Yu N (2003) The human hepatic metabolism of simvastatin hydroxy acid is mediated primarily by CYP3A and not CYP2D6. Br J Clin Pharmacol 56: 120-124.[CrossRef][Medline]

Ridtitid W, Wongnawa M, Mahatthanatrakul W, Punyo J, and Sunbhanich M (2002) Rifampin markedly decreases plasma concentrations of praziquantel in healthy volunteers. Clin Pharmacol Ther 72: 505-513.[Medline]

Rodrigues AD (1999) Integrated cytochrome P450 reaction phenotyping. Biochem Pharmacol 57: 465-480.[CrossRef][Medline]

Sahi J, Black CB, Hamilton GA, Zheng X, Jolley S, Rose KA, Gilbert D, LeCluyse EL, and Sinz MW (2003) Comparative effects of thiazolidinediones on in vitro P450 enzyme induction and inhibition. Drug Metab Dispos 31: 439-446.[Abstract/Free Full Text]

Shimada T, Yamazaki H, Mimura M, Inui Y, and Guengerich FP (1994) Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J Pharmacol Exp Ther 270: 414-423.[Abstract/Free Full Text]

Smith DA (2000) Induction and drug development. Eur J Pharm Sci 11: 185-189.[CrossRef][Medline]

Tran JQ, Kovacs SJ, McIntosh TS, Davis HM, and Martin DE (1999) Morning spot and 24-hour urinary 6ß-hydroxycortisol to cortisol ratios: intraindividual variability and correlation under basal conditions and conditions of CYP 3A4 induction. J Clin Pharmacol 39: 487-494.[Abstract]

Villikka K, Kivistö KT, and Neuvonen PJ (1999) The effect of rifampin on the pharmacokinetics of oral and intravenous ondansetron. Clin Pharmacol Ther 65: 377-381.[CrossRef][Medline]

Watkins PB, Wrighton SA, Schuetz EG, Molowa DT, and Guzelian PS (1987) Identification of glucocorticoid-inducible cytochromes P-450 in the intestinal mucosa of rats and man. J Clin Investig 80: 1029-1036.[Medline]

Wrighton SA, Brian WR, Sari MA, Iwasaki M, Guengerich FP, Raucy JL, Molowa DT, and Vandenbranden M (1990) Studies on the expression and metabolic capabilities of human liver cytochrome P450IIIA5 (HLp3). Mol Pharmacol 38: 207-213.[Abstract]

Zhuo X, Zheng N, Felix CA, and Blair LA (2004) Kinetics and regulation of cytochrome P450-mediated etoposide metabolism. Drug Metab Dispos 32: 993-1000.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
C. Tang, B. A. Carr, F. Poignant, B. Ma, S. L. Polsky-Fisher, Y. Kuo, K. Strong-Basalyga, A. Norcross, K. Richards, R. Eisenhandler, et al.
CYP2C75-Involved Autoinduction of Metabolism in Rhesus Monkeys of Methyl 3-Chloro-3'-fluoro-4'-{(1R)-1-[({1-[(trifluoroacetyl)amino]cyclopropyl}carbonyl)amino]ethyl}-1,1'-biphenyl-2-carboxylate (MK-0686), a Bradykinin B1 Receptor Antagonist
J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 935 - 946.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
R. Kitamura, Y. Yamamoto, S. Nagayama, and M. Otagiri
Decrease in Plasma Concentrations of Antiangiogenic Agent TSU-68 ((Z)-5-[(1,2-Dihydro-2-oxo-3H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-propanoic acid) during Oral Administration Twice a Day to Rats
Drug Metab. Dispos., September 1, 2007; 35(9): 1611 - 1616.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dmd.105.007997v1
34/6/950    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimizu, T.
Right arrow Articles by Chiba, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimizu, T.
Right arrow Articles by Chiba, K.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition