![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
National Research Centre for Environmental Toxicology, University of Queensland, Brisbane, Queensland, Australia (A.A.-B., M.R.M); Department of Pharmacology and Toxicology, University of Oulu, Oulu, Finland (V.L., S.A., J.H.); and Division of Pharmaceutical Biochemistry, Uppsala Biomedical Centre, Uppsala University, Uppsala, Sweden (M.A.L.)
(Received December 19, 2006; accepted February 12, 2007)
| Abstract |
|---|
|
|
|---|
Depending on the inducer, the activation of hepatic CYP2A5 can be achieved both by transcriptional and post-transcriptional mechanisms. Transcriptional induction of Cyp2a5 by 2,3,7,8-tetrachlorodibenzo-p-dioxin is mediated by the binding of a ligand-activated aryl hydrocarbon receptor (AHR)/aryl hydrocarbon receptor nuclear translocator (ARNT) complex to the xenobiotic response element (XRE) site at the Cyp2a5 distal promoter (Arpiainen et al., 2005
). Pyrazole, a hepatotoxin, induces CYP2A5 by a post-transcriptional mechanism involving binding of heterogenous nuclear ribonucleoprotein A1 to the 3'-untranslated region of CYP2A5 mRNA, with subsequent stabilization of the mRNA (Glisovic et al., 2003
).
However, given the structural diversity of the inducers, it is possible that induction of CYP2A5 is not directly related to the nature of the inducing agents, but instead may be an indirect consequence of a specific cellular event associated with the pathogenesis of liver injury. For example, certain agents may disturb cellular redox status, a common denominator that may consequently induce the expression of CYP2A5 through activation of stress-related transcription factors, such as the nuclear factor (erythroid-derived 2)-like 2 (Nrf2). In support of this hypothesis are the observations that 1) overexpression of CYP2A5 by pyrazole is related to alterations in cellular redox equilibrium (Gilmore and Kirby, 2004
); 2) pyrazole treatment in mice increased Nrf2 protein in the liver (Gong and Cederbaum, 2006
); and 3) cadmium, an agent that alters cellular redox status, induces CYP2A5 expression in Nrf2+/+ mice but not in Nrf2/ mice (Abu-Bakar et al., 2004
).
Nrf2, a basic-leucine zipper protein, regulates coordinated activation of a battery of genes in response to oxidative stress. These include genes that encode phase II drug-metabolizing enzymes such as NAD-(P)H:quinone oxidoreductase,
-glutamylcysteine synthase, and glutathione S-transferase (Kang et al., 2005
); haem oxygenase-1 (HO-1) (Alam et al., 1999
); and thioredoxin (Kim et al., 2001
). Under normal conditions, Nrf2 exists in an inactive, cytoplasm-localized state, in part or fully as a consequence of binding to the cytoskeleton-associated protein Keap1 (Itoh et al., 1999
). On cellular stimulation by stress agents, Nrf2 is dissociated from Keap1, which then leads to stabilization and nuclear translocation of Nrf2 by a, as yet, poorly characterized mechanism(s). However, cadmium alters cellular redox by reducing the intracellular ratio of glutathione to oxidized glutathione (Ryter and Choi, 2002
) and activates dissociation of the Nrf2-Keap1 complex through p38 mitogen-activated protein kinase-mediated phosphorylation of Keap1 (Alam et al., 2000
). The phosphorylation may take place either directly or indirectly through intermediary kinases, thus inhibiting rapid degradation of Nrf2 by ubiquitination (Stewart et al., 2003
). In the nucleus, Nrf2 dimerizes with small Maf proteins (Itoh et al., 1995
) or other basic-leucine zipper proteins, including Jun family members (Venugopal and Jaiswal, 1998
). The resulting heterodimers, in turn, bind to cis-elements with similar core sequences, alternatively known as Maf recognition elements (Kataoka et al., 1994
), antioxidant response elements (Rushmore et al., 1991
), or stress response elements (StRE) (Choi and Alam, 1996
), to regulate target genes transcription.
The aim of the present study was to elucidate the potential role of Nrf2 in cadmium-mediated Cyp2a5 regulation. The results show existence of Nrf2 binding sites at the Cyp2a5 promoter and that cadmium activates binding of Nrf2 to an StRE at about 2.4 kilobase upstream of the transcription start site of the Cyp2a5 promoter, which in turn up-regulates the CYP2A5. The present evidence represent a novel mechanism in the regulation of phase I xenobiotic-metabolizing gene.
| Materials and Methods |
|---|
|
|
|---|
Isolation and Treatment of Primary Culture Hepatocytes. Hepatocytes were isolated from male DBA/2 mice (Möllegaard, Copenhagen, Denmark) aged 8 to 10 weeks. Livers were perfused with collagenase solution as described previously (Seglen, 1972
). After filtration and centrifugation, the isolated hepatocytes were dispersed in Williams' E medium containing 20 ng/ml dexamethasone; insulin, transferrin, sodium selenite media supplement (5 mg/l insulin, 5 mg/l transferrin, and 5 µg/l sodium selenite); 10 µg/ml gentamicin; 1% L-glutamine; and 10% decomplemented fetal calf serum at a density of 1.8 x 106 cells/60-mm uncoated culture dish (Corning, Palo Alto, CA) and 3 x 105 cells/well on 12-well plates. The cultures were maintained at 37°C in 5% CO2 in a humidifier incubator. After 2 h of incubation, the medium was replaced with serum-free Williams' E medium. The cultures were maintained for additional 24 h before treatment with 4 µM CdCl2 solution or transient transfection. CdCl2 was dissolved in normal saline solution.
Animals. Six 8- to 10-week-old DBA/2 male mice (Animal Resources Centre, Murdoch, WA, Australia) were divided into two groups of three mice in each group. They were housed in filter-top polycarbonate cages containing wood chip bedding and maintained in a 12-h light/dark cycle with free access to standard mouse chow and tap water. They were treated with a single i.p. injection of 16 µmol CdCl2/kg b.wt. dissolved in normal saline solution. The animals in the control group were given normal saline only. The mice were sacrificed at 8 h after treatment by CO2 overdose. The livers of individual animals were excised. All the experimental procedures were approved by, and conducted in accordance with, the animal experimentation guidelines of the Queensland Health Scientific Services Animal Ethics Committee and the University of Queensland Animal Ethics Committee.
Isolation of Nuclear and Cytoplasmic Proteins. Nuclear and cytoplasmic extracts from primary hepatocytes were prepared as described previously (Geneste et al., 1996
). Hepatocytes were washed and resuspended in phosphate-buffered saline. The cell suspension was centrifuged at 2000g for 30 s. The resulting pellet was resuspended in buffer A (10 mM HEPES-KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.2 mM PMSF, 10 µg/ml leupeptin, and 0.4% Igepal) and kept on ice for 1 h. The cell suspension was vortexed, homogenized, and centrifuged at 12,000g at 4°C for 10 min. The supernatant containing cytoplasmic proteins was aliquoted and stored at 80°C. The pellet containing the nuclei was resuspended in buffer B (20 mM HEPES-KOH, pH 7.6, 1.5 mM MgCl2, 420 nM NaCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.5 mM PMSF, and 0.4% Igepal) and gently agitated for 30 min at 4°C. The suspension was centrifuged at 15,000g for 15 min at 4°C. The supernatant containing the nuclear proteins was aliquoted and stored at 80°C. Protein content was measured by Lowry method (Lowry et al., 1951
).
Isolation of Nuclear Proteins from Mouse Liver. Briefly, fresh liver (about 1 g) was rinsed in ice-cold Tris-buffered saline and homogenized in homogenizing buffer (10 mM HEPES, pH 7.6, 15 mM KCl, 1 mM EDTA, 2 M sucrose, 10% glycerol, 0.5 mM spermidine, 0.15 mM spermin, 0.5 mM DTT, 0.5 mM PMSF, and 10 µg/ml leupeptin). The homogenate was poured into a centrifuge tube containing equal volume of homogenizing buffer and centrifuged at 100,000g for 50 min at 4°C. The supernatant was discarded, and the pellet was washed by dissolving in 50 mM Tris, pH 8.0, 40% glycerol, 5 mM EDTA, and 5 mM MgCl2 and centrifuged at 10,000g for 5 min at 4°C. The supernatant was discarded, and the intact nuclei were resuspended in 50 mM Tris, pH 8.0, 40% glycerol, 5 mM EDTA, and 5 mM MgCl2; aliquoted; and stored at 80°C. Nuclear proteins were extracted from the intact nuclei by pelleting the suspended nuclei (centrifugation at 10,000g for 5 min at 4°C). The pellet was resuspended in buffer A (10 mM HEPES, pH 7.6, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT, and 0.5 mM PMSF) and stirred with magnetic stirrer for 30 min at 4°C. The suspension was homogenized by pestling (10 strokes x 2) and centrifuged at 15,000g for 5 min at 4°C. The nuclear proteins were obtained by dialyzing the nuclei (supernatant) against 100 volumes of buffer B (20 mM HEPES, pH 7.6, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 0.5 mM DTT, and 0.5 mM PMSF) overnight at 4°C. This was done by pipetting the nuclei onto a nitrocellulose membrane (Millipore Corporation, Billerica, MA) floating over 100 volumes of buffer B. The dialyzed sample was centrifuged at 15,000g for 5 min at 4°C, and the supernatant was aliquoted and stored at 80°C.
RNA Extraction and mRNA Analysis. Total cellular RNA was extracted from primary mouse hepatocytes using the RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany). Messenger RNA levels were determined by Northern blotting. Total RNA (10 µg) was size-fractionated on a 1.2% agarose/formaldehyde gel and transferred to a Hybond-N nylon membrane (Amersham Biosciences, Buckinghamshire, UK). The CYP2A5 cDNA and HO-1 cDNA were radiolabeled with [
-32P]dCTP using the Megaprime labeling kit (Amersham Biosciences). Successive hybridizations were carried out on the same filter using the cDNA probes (1.7 x 107 cpm of radiolabeled probe) at 65°C overnight in Church buffer (Church and Gilbert, 1984
) (modified to contain 0.25 M phosphate buffer, 7% SDS, and 1 mM EDTA). The filter was washed twice for 5 min at room temperature in a buffer containing 2x standard saline citrate and 0.1% SDS and then once for 15 min at 65°C in a buffer containing 2x standard saline citrate and 1% SDS. To assess equal loading of the samples, the mRNA level of the housekeeping gene, glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) was measured using the GAPDH cDNA (CLONTECH, Palo Alto, CA) as a probe. For the densitometric analysis, scanning of the film was performed with a Scanjet 3500c scanner (Hewlett Packard, Palo Alto, CA), and quantification was conducted using the software NIH Image 1.61 (http://rsb.info.nih.gov/nih-image/).
Protein Analysis. Protein levels were determined by Western blotting. Proteins (20 µg of cytosolic protein for detection of CYP2A5 and HO-1 proteins; 15 µg of cytosolic or nuclear protein for detection of Nrf2 protein) were separated by SDS-polyacrylamide gel electrophoresis (12%), electrophoretically transferred to nitrocellulose/polyvinylidene difluoride membranes (Pierce Biotechnology, Rockford, IL/Bio-Rad Laboratories, Hercules, CA), and blocked for 1 h in phosphate-buffered saline containing Tween 20 (0.1%) and nonfat milk (5%). Blots were incubated with the HO-1 (1:500 dilution), CYP2A5 (1:1000 dilution), or Nrf2 (1:500 dilution) antibody for 3 h. Membranes were then incubated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit (1:5000 dilution) or goat anti-mouse (1:5000 dilution) antibody. After further washing with phosphate-buffered saline, blots were incubated in commercial chemoluminescence reagents (Amersham Biosciences). The catalytic activity of CYP2A5 was determined by measuring coumarin 7-hydroxylase (COH) as described previously (Aitio, 1978
) using 50 µgof cytoplasmic extracts from primary hepatocytes and 100 µM coumarin as substrate.
Plasmids and Transient Transfection Assays. The Cyp2a5 5'3033/+10 fragment (Ulvila et al., 2004
) and the 5'-truncated fragments of the Cyp2a5 promoter cloned in front of the luciferase cDNA in the pGL3-Basic vector (Promega, Madison, WI) were used in transient transfection assays. Promoter constructs were cotransfected either with the empty expression plasmid pcDNA3 or with the mouse Nrf2 expression plasmid (pcDNA3-mNrf2). To prepare a positive control for the luciferase activity assays, a functional StRE site (5'-GATCTTTTATGCTGAGTCATGGTTT-3', core sequence underlined) from the hmox-1 promoter region was cloned between the cloning sites KpnI and XhoI in the pGL3-TK plasmid, which contained the thymidine kinase promoter from pRL3-TK plasmid (Promega) subcloned between the cloning sites BglII and HindIII. Mouse primary hepatocytes were transiently transfected after 24 h of culturing using Tfx-20 reagent (Promega) according to the manufacturer's protocol in Opti-MEM I medium (Invitrogen, Carlsbad, CA). Cells in each well were transfected with 0.5 µgof Cyp2a5 5' reporter construct, 0.1 µg of pcDNA3 or pcDNA3-mNrf2, and 0.2 µgof pRL3-TK. The transfected cells were cultured 48 h before measuring the luciferase activities by the Dual-Luciferase Reporter Assay System (Promega).
Electrophoretic Mobility Shift Assay. Double-stranded DNA corresponding to either the 2597 to 2419 region (probe 1) or the 2467 to 2269 region (probe 2) of the 5'-flanking Cyp2a5 promoter were generated by polymerase chain reaction (PCR). Primers 1 and 2 were used to amplify probe 1, whereas primers 3 and 4 were used to amplify probe 2. The sequences of the primers are shown in Table 1. The single-stranded oligonucleotides were obtained from Sigma-Genosys (Sydney, NSW, Australia). The PCR products were purified with the QIAquick PCR Purification Kit (QIAGEN) following the manufacturer's protocol. The PCR-derived oligonucleotides (probes 1 and 2) were 5'-end labeled with [
-32P]ATP (3000 Ci/mmol) using a 5'-end labeling kit (Promega) and purified using the QIAquick nucleotide removal kit (QIAGEN). Ten microliters of binding buffer [4% glycerol, 5 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris-HCl, pH 7.5, and 0.05 mg/ml poly(dI-dC) (Amersham Biosciences)] and 10 µg of liver nuclear extract from control or cadmium-treated mice were incubated at room temperature for 10 min. After incubation, 1 x 105 cpm of labeled DNA was added, and the mixtures were incubated for an additional 20 min at room temperature. In antibody supershift assays, 1 µl of anti-Nrf2, anti-Fos, or anti-Jun antibody was added to the reaction mixture and incubated on ice for 60 min. For electrophoresis separation of the DNA-protein complexes, the samples were loaded onto a pre-electrophoresed, nondenaturing 4% polyacrylamide (60:1 acrylamide/bisacrylamide) gel in 0.5x Tris borate-EDTA (44 mM Tris-HCl, pH 8, 44 mM boric acid, and 1 mM EDTA). The samples were electrophoresed at 10 mA for 270 min, after which the gel was dried and autoradiographed.
|
Competition binding assay was conducted to assess the specificity of protein-DNA interactions. In this assay, 100-fold molar excess of unlabeled oligonucleotides was added to the incubation mixture. The double-stranded consensus NF-E2 oligonucleotide 5'-TGGGGAACCTGTGCTGAGTCACTGGAG-3' (core StRE sequence is underlined) was used as positive control for Nrf2-specific binding.
Chromatin Immunoprecipitation Assay. Protein-DNA complexes were immunoprecipitated from murine primary hepatocytes (cultured in 175-cm2 flasks). Two hours after liver perfusion, cells were either treated with 4 µM CdCl2 or maintained in serum-free culture medium for 30 min. Chromatin immunoprecipitation (ChIP) was done according to Väisänen et al. (2004
). Briefly, transcription factors were cross-linked to DNA by treatment of the cells with 1% formaldehyde for 10 min at 37°C. The cells were then washed, pelleted, and resuspended in 2 ml of SDS lysis buffer. Lysates were sonicated to shear the chromatin to DNA length of between 200 and 1000 base pair (bp). The lysate was precleared with 50% salmon sperm DNA/protein A agarose slurry (Upstate, Charlottesville, VA) and fractionated into 200-µl aliquots. Fifty microliters was reserved as the total chromatin input sample. Two hundred-microliter aliquots were diluted 10-fold in ChIP dilution buffer and incubated with 1 µg of anti-Nrf2 antibody or rabbit IgG (negative control) overnight at 4°C. Immunocomplexes were collected with 100 µl of 50% protein A agarose slurry and eluted with 500 µl of elution buffer. Protein-DNA cross-links were reversed by overnight incubation at 65°C, and remaining proteins were digested with proteinase K. After washing and elution, DNA was purified by phenol/chloroform/isoamyl alcohol extraction and resuspended in 60 µl of H2O. Confirmation of Nrf2 binding site was performed by quantitative real-time PCR (AmpliQ Universal Real Time PCR Master Mix Kit, Ampliqon, Copenhagen, Denmark). Five microliters of DNA solution was used as template in 20-µl PCR reactions containing 10 µl of the 2x master mix, 2 µl of Green DNA Dye (1:2000), and each PCR primer at 200 nM (see Table 1). Samples were incubated at 95°C for 15 min, followed by 45 cycles of 95°C for 30 s, 55°C for 1 min, and 72°C for 30 s in an Mx3000P quantitative PCR system (Stratagene, La Jolla, CA). The specificity of the PCR products was confirmed by melting curve analysis and size (agarose gel electrophoresis).
Site-Directed Mutagenesis. The potential StRE sites at 2514 to 2505 and 2386 to 2377 bp, respectively, were analyzed by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) as instructed by the manufacturer. The former element was analyzed by using an existing mutagenesis construct (Arpiainen et al., 2005
). Mutagenesis of the latter element was performed by using the Cyp2a5 5'3033/+10 luciferase reporter plasmid as template and by priming with mutated oligonucleotides 2401 CGTGACTTCAGTTTCTGCTCTTCTATCCATGCGTCTGAAAAGAAG 2357 (bold, mutated bases; underlined, core sequence). Presence of the mutated bases was confirmed by sequencing.
Statistical Analysis. Student's t test was used for comparisons between two groups. Comparisons of several groups were done with one-way analysis of variance (ANOVA) followed by the least significant difference post hoc test. Differences were considered significant when p < 0.05.
|
| Results |
|---|
|
|
|---|
|
|
|
Identification and Characterization of a Putative Nrf2 Binding Element. Cadmium-induced hmox-1 transcriptional activation is mediated by Nrf2 binding to the StRE, which is present in multiple copies in the mouse hmox-1 promoter (Sikorski et al., 2004
). We next searched for putative Nrf2 binding sites in the 5'-flanking region of the Cyp2a5 gene. A transcription factor binding site search was performed using the TFSEARCH program. The search exposed two regions of high sequence similarity with the consensus StRE [5'-(T/C)GCTGAGTCA-3']. The two potential StRE identified are at positions 2514 to 2505 and 2386 to 2377 of the Cyp2a5 5'-flanking region (Fig. 5A). The location of these binding sites is within the Nrf2 responsive region identified in the transfection experiments. The difference between these putative and the consensus StRE sequence is only 2 bp (Fig. 5B).
|
Next, binding activity of Nrf2 to the two putative sites was tested. Electrophoretic mobility shift assays (EMSA) were performed with liver nuclear extracts from untreated and cadmium-treated mice, using the two potential Nrf2-binding sites as probes. Probe 1 encompassed sequences from 2597 to 2419 (distal putative StRE), and probe 2 encompassed sequences from 2467 to 2269 (proximal putative StRE). Figure 5C shows that a distinct, cadmium-dependent DNA-protein complex (open arrow) was formed with both probes (lanes 3 and 11). The complex with the probe 1 was not competed by 100-fold excess of unlabeled consensus StRE oligo, nor was the complex supershifted with anti-Nrf2 antibody. This result suggests that the complex does not contain Nrf2. In contrast, the complex with the probe 2 was inhibited, although not totally abolished by competition with the unlabeled consensus StRE oligo. Moreover, anti-Nrf2 antibody was able to supershift this complex, which confirmed that the complex involves Nrf2 (closed arrow, lane 12).
The StRE binding sequences typically overlap with activator protein-1 binding motif. In our EMSA assay, anti-Fos antibody could induce supershifted complex, and anti-Jun antibody inhibited complex formation (Fig. 5C). Therefore, c-Fos/c-Jun dimer may compete with Nrf2 complex for binding. Alternatively, c-Fos and c-Jun may be potential heterodimerization partners for Nrf2 in the regulation of the Cyp2a5 gene.
Binding of Nrf2 to the Cyp2a5 promoter StRE was confirmed by ChIP experiment. Primary hepatocytes were treated with 4 µM CdCl2 for 30 min or left untreated, and the fixed DNA-protein complexes were immunoprecipitated with anti-Nrf2 antibody. Extracted DNA fragments were amplified in real-time PCR with a primer pair spanning the proximal Cyp2a5 StRE (Fig. 5A). Anti-Nrf2 antibody precipitated Nrf2 bound to Cyp2a5 promoter only from cadmium-treated cells (Fig. 5D). This indicates that Nrf2 binds to Cyp2a5 promoter at proximal StRE in vivo, in true chromatin structure, and this binding is cadmium-dependent.
Proximal StRE Mediates Nrf2 Response of the Cyp2a5 Gene. To establish the functional significance of the identified proximal StRE element at 2467 to 2269, the core element critical for Nrf2 binding was mutated in the Cyp2a5 3033/+10-Luc construct. The distal StRE, which does not bind the Nrf2, was also mutated and used as a control. The mutant constructs were then cotransfected with the Nrf2 expression plasmid into mouse primary hepatocytes. Mutation of the proximal StRE (Cyp2a5-5'-3033-2379mut) abolished the Nrf2 response in reporter gene assays, whereas mutation of the distal StRE (Cyp2a5-5'-3033-2505mut) had no effect (Fig. 6). These results indicate that the identified proximal StRE is functional and mediates the activation of Cyp2a5 transcription by Nrf2.
|
| Discussion |
|---|
|
|
|---|
The cellular detoxifying system uses phase I and II xenobiotic-metabolizing enzymes. The phase I metabolism by P450 enzymes may produce reactive oxygen species that activate Nrf2 nuclear translocation and transcription of antioxidant genes. For example, induction of CYP2E1 by ethanol is one of the central pathways by which ethanol generates a state of oxidative stress in hepatocytes. This in turn activates Nrf2-dependent HO-1 expression, which in turn protects cells against oxidative injury (Cederbaum, 2006
; Gong and Cederbaum, 2006
). Oxidative metabolism by P450 enzymes may also produce electrophilic intermediary metabolites that activate Nrf2-dependent transcription of phase II genes. Thus, P450s are not considered as Nrf2 target genes. However, the evidence presented in this report indicates a unique role for the CYP2A5 among the P450 enzymes.
The nature of that specific role is not apparent in this study. However, earlier studies showed that genes that are regulated by the Nrf2-StRE pathway encode proteins that help control the cellular redox status and defend the cell against oxidative damage. For example, HO-1 catalyzes the degradation of haem to the potent antioxidants biliverdin and bilirubin (BR) (Choi and Alam, 1996
). In 1990, Stocker (1990
) proposed that induction of HO-1 represents an antioxidant defense operating at two different stages simultaneously by 1) decreasing the levels of the potential pro-oxidants haem and haemoproteins such as the cytochromes; and 2) increasing the cellular concentrations of potent antioxidants, biliverdin and BR. However, excess concentrations of BR are toxic and need to be dynamically controlled. BR is normally conjugated with glucuronic acid and excreted in the bile. When glucuronidation is impaired, oxidative BR metabolism offers an alternative degradation pathway (Schmid and Hammaker, 1963
). We have previously shown that in vivo treatment of CdCl2 to DBA/2 mice caused coordinated induction of the HO-1 and CYP2A5 at mRNA, protein, and enzyme activity levels, whereas the total P450 content was reduced significantly (Abu-Bakar et al., 2005
). Enzyme kinetic analysis established that CYP2A5 plays an important role in microsomal BR oxidation, when BR levels were elevated following induction of HO-1 by cadmium (Abu-Bakar et al., 2005
). Thus, we hypothesize that under the condition of oxidative stress exerted by cadmium, activation of Nrf2-dependent HO-1 leads to drastic elevation of BR concentration, which may overwhelm BR oxidant scavenging activity. This in turn creates a need for BR to be enzymatically metabolized. Transcriptional activation of Cyp2a5 gene through Nrf2 may thus function as part of the protective network that maintains dynamic control of BR levels and redox homeostasis.
Given that CYP2A5 is also induced by bifunctional agents, such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (Arpiainen et al., 2005
), it is plausible that this enzyme plays a role in the dynamic balance between electrophile-producing phase I and inactivating phase II enzyme systems to protect cellular homeostasis. A central example of this coordination is through interaction of the AHR-XRE and the Nrf2-StRE pathways. The AHR ligands are able to activate genes by interaction with XRE and therefore induce P450 genes especially in family 1. In addition, AHR is able to activate some phase II genes through XRE sequence motifs in their promoters, as well as indirectly through StRE sites via Nrf2. This process may involve several mechanisms. The phase I metabolism by P450 enzymes may produce electrophilic intermediary metabolites and reactive oxygen species that activate Nrf2 nuclear translocation and the transcription of phase II genes. Furthermore, a recent study showed that AHR is able to activate Nrf2 gene transcription by binding to XRE of the Nrf2 promoter (Miao et al., 2005
). Our previous work reported that Cyp2a5 is a direct target of AHR (Arpiainen et al., 2005
). Thus, it represents a gene controlled both by AHR and Nrf2. The two binding sites are located in relatively close proximity (less than 150 bp) of the Cyp2a5 promoter (Fig. 5A). This suggests that these binding sites may form a functional regulatory unit. It seems probable that AHR ligands may activate Cyp2a5 transcription directly through XRE and indirectly through StRE to enhance expression of CYP2A5 under conditions of oxidative stress.
AHR may play an additional role in CYP2A5-controlled BR homeostasis under oxidative stress conditions. BR has been reported to induce activation of the AHR-signaling system in hepatoma cells of mouse, rat, and human origin (Phelan et al., 1998
). It is plausible the excess BR produced by HO-1 may cause substrate-mediated transcriptional regulation of the Cyp2a5 gene, where BR may serve as an endogenous ligand to the AHR, which then triggers the AHR-dependent XRE-mediated transcriptional activation of the Cyp2a5 gene. Furthermore, AHR may amplify Nrf2-mediated Cyp2a5 induction by increasing Nrf2 expression level.
In conclusion, the present findings show that the Cyp2a5 gene is under the direct control of Nrf2 through StRE site in the 5'-flanking region. Therefore, Cyp2a5 represents the first example of a P450 gene regulated by oxidative stress through Nrf2. Thus, we propose that the CYP2A5 is involved in the cellular network that maintains redox homeostasis to protect cells from oxidative stress.
| Acknowledgments |
|---|
| Footnotes |
|---|
A.A.-B. and V.L. contributed equally to this work.
Article, publication date, and citation information can be found at http://dmd.aspetjournals.org.
ABBREVIATIONS: P450, cytochrome P450; AHR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon receptor nuclear translocator; XRE, xenobiotic response element; Nrf2, nuclear factor (erythroid-derived 2)-like 2; HO-1, haem oxygense-1; StRE, stress response element(s); CdCl2, cadmium chloride; PMSF, phenylmethylsulfonyl fluoride; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; COH, coumarin 7-hydroxylase; PCR, polymerase chain reaction; ChIP, chromatin immunoprecipitation; bp, base pair; ANOVA, analysis of variance; EMSA, electrophoretic mobility shift assay(s); BR, bilirubin.
Address correspondence to: A'edah Abu-Bakar, National Research Centre for Environmental Toxicology, University of Queensland, 39 Kessels Road, Coopers Plains, 4108 QLD, Australia. E-mail: a.abubakar{at}uq.edu.au
| References |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||