![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Divisions of Biomedical Analysis (S.H., J.H.B., J.H.M.S., I.M.) and Pharmacology and Pathophysiology (A.S.K.), Department of Pharmaceutical Sciences, Faculty of Science, Utrecht University, Utrecht, The Netherlands; Department of Pharmacy and Pharmacology, Slotervaart Hospital, Amsterdam, The Netherlands (J.H.B.); and Department of Medical Oncology, The Netherlands Cancer Institute, Amsterdam, The Netherlands (J.H.M.S.)
(Received June 21, 2007; Accepted March 14, 2008)
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
). Therefore, several strategies to study CYP3A4 induction have been developed. Phenotyping studies, such as the erythromycin breath test, can be used directly to measure cytochrome P450 induction in humans. However, this method has some serious disadvantages, like the invasive administration of probe substances to humans, labor-intensive protocols, large interindividual differences, and difficulties in processing and interpreting the results. Also, the use of animals for both in vivo and in vitro studies poses problems because there are large interspecies differences in the CYP3A4 induction capacity of compounds (Lehmann et al., 1998). Therefore, CYP3A4 induction is mainly studied in vitro in primary cultures of human hepatocytes, which are considered to mostly resemble the in vivo situation. However, the interindividual donor variability, rapid loss of drug-metabolizing enzyme expression, poor availability, and the costs are major drawbacks (Brandon et al., 2003).
The finding that the highly promiscuous pregnane X receptor (PXR; NR1I2) (Moore et al., 2000) is one of the main regulators of CYP3A4 induction has led to the development of CYP3A4 reporter gene assays. These assays are based on the transient transfection of a cell line with a CYP3A4 reporter construct containing the response elements of PXR located in the proximal (–362/+53) and distal (–7836/–7208) promoter regions of the CYP3A4 gene linked to a firefly luciferase or other reporter genes such as alkaline phosphatase (Goodwin et al., 1999). In contrast to hepatocytes, many cell lines express lower levels or even no PXR (Thummel et al., 2001; Swales et al., 2003; Phillips et al., 2005). Therefore, cell lines used for the reporter gene assay are often cotransfected with a PXR expression plasmid to increase the levels of this nuclear receptor. Since two other nuclear receptors, the constitutive androstane receptor (CAR; NR1I3) (Kawamoto et al., 1999) and the vitamin D receptor (VDR; NR1I1) (Kolars et al., 1992), are also known to regulate CYP3A4 induction, cells can also be cotransfected with CAR or VDR instead of PXR. At the moment, cell-based reporter gene assays have become suitable alternatives to primary cultures of human hepatocytes to study nuclear receptor-mediated CYP3A4 induction. Although nuclear receptor expression levels in these reporter gene assays are raised artificially, a good correlation between PXR-mediated CYP3A4 induction measured in a reporter gene assay and CYP3A4 mRNA (Roymans et al., 2005) and protein (Luo et al., 2004) expression in primary cultures of human hepatocytes was reported. Furthermore, by comparing CYP3A4 reporter gene assay data and known data on CYP3A4 induction in vivo, Persson et al. (2006) showed that a CYP3A4 reporter gene assay is a reliable screening method for the assessment of drug-induced CYP3A4 expression (Persson et al., 2006).
Currently, the cell line most often used in CYP3A4 reporter gene assays is the human hepatocarcinoma-derived HepG2 cell line (Ogg et al., 1997, 1999; El-Sankary et al., 2001; Luo et al., 2004; Trubetskoy et al., 2005; Noracharttiyapot et al., 2006; Sinz et al., 2006; Huang et al., 2007). However, HepG2 mainly expresses the fetal enzyme CYP3A7 instead of CYP3A4 (Schuetz et al., 1993). In addition, despite the presence of endogenous PXR, CYP3A4 expression is not enhanced by rifampicin treatment in HepG2 cells (Ogino et al., 2002). Since CYP3A4 is also present in the gastrointestinal tract and has been shown to contribute significantly to the prehepatic metabolism of drugs (Kolars et al., 1992), other groups use the human colon carcinoma-derived LS180 cell line as a host for their CYP3A4 reporter gene assay (Synold et al., 2001; Zhou et al., 2004). In contrast to HepG2, rifampicin was shown to increase CYP3A4 expression in LS180 cells (Schuetz et al., 1996) Moreover, in a comparison among three colon carcinoma cell lines (LS180, CaCo-2, and TC-7), only LS180 showed inducible CYP3A4 expression (Pfrunder et al., 2003).
The aim of this study was to investigate the suitability of LS180 cells as a model to study CYP3A4 induction in comparison with the widely used HepG2 cell line. Therefore, CYP3A mRNA and protein expression levels in both cell lines were determined after treatment with prototypical nuclear receptor agonists [rifampicin (PXR), CITCO (CAR), calcitriol (VDR)] that are known inducers of CYP3A4. Furthermore, the use of these cell lines as hosts for CYP3A4 reporter gene assays was evaluated.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids. The pGL3-CYP3A4-XREM (proximal, –362/+53; distal, –7836/–7208) luciferase reporter construct and the pEF-hCAR expression plasmid were kind gifts from Dr. Richard Kim (Vanderbilt University, Nashville, TN), the pCDG-hPXR expression vector was generously provided by Dr. Ron Evans (The Howard Hughes Medical Institute, La Jolla, CA), the pSG5-hVDR expression plasmid was kindly donated by Dr. Bandana Chatterjee (Department of Molecular Medicine/Institute of Biotechnology, University of Texas Health Science Centre, San Antonio, TX), and the pRL-TK control plasmid was obtained from Promega (Madison, WI). Plasmids were checked by enzyme restriction and agarose gel electrophoresis and purified using Promega's Pureyield Midi-prep according to the instructions of the manufacturer.
Cell Culture. The human colon adenocarcinoma-derived cell line, LS180 (used between passages 12 and 14), and the human hepatoma-derived cell line, HepG2 (used between passages 13 and 15) were purchased from the American Type Culture Collection (Manassas, VA). The cell lines were maintained in RPMI 1640 ++ medium [with 25 mM HEPES and L-glutamine, supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin] at 37°C under a humidified atmosphere of 5% CO2.
Treatment. HepG2 and LS180 cells were plated at a density of 1 x 106 cells/well in six-well plates (Greiner Bio-One BV, Alphen a/d Rijn, The Netherlands) in 2 ml of RPMI 1640 medium++. After reaching 80 to 90% confluency, medium was replaced with medium containing different concentrations of rifampicin (1 or 10 µM), CITCO (10 or 250 nM), or calcitriol (1 or 100 nM) and refreshed after 24 h. The final solvent concentrations did not exceed 0.1%. After 48 h, cells were washed with phosphate-buffered saline (PBS). The cells were further used for immunoblot analysis or quantitative polymerase chain reaction as described below.
RNA Extraction and Reverse Transcription-PCR. Total RNA was extracted using the GeneElute Mammalian total RNA miniprep kit (Sigma-Aldrich). RNA integrity and quantity were determined using a Nanodrop Diode Array Spectrophotometer (Isogen Life Science, Ijsselstein, The Netherlands). One microgram of total RNA was reverse transcribed according to the manufacturer guidelines concerning the random hexamer primer (RevertAid First Strand cDNA synthesis kit; Fermentas, St. Leon-Rot, Germany).
Quantitative Reverse Transcription-PCR. The CYP3A4, CYP3A5, CYP3A7, and 18S mRNA expression levels were analyzed using an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA). All reactions were singleplexed with 18S. Oligonucleotide primers and a Taqman probe for CYP3A4 were as follows: forward, TCAATAACAGTCTTTCCATTCCTCAT; reverse, CTTCGAGGCGACTTTCTTTCA; and probe, TGTTTCCAAGAGAAGTTACAAA. The primers and probe used for 18S, CYP3A5 (Hs00241417_m1), and CYP3A7 (Hs00426361_m1) real-time PCR were commercially available Assay on Demand kits (Applied Biosystems). According to manufacturer guidelines, data were expressed as threshold cycle value (ct) and used to determine dct values. -Fold changes in expression were calculated according to the following transformation: -fold increase = 2–(difference in delta ct).
Immunoblot Analysis. After 48 h, cells were harvested and lysed in 250 µl of PBS containing 1% Triton X-100, 0.1% SDS, 1 mM dithiothreitol, and 1% protease inhibitor cocktail tablet (Roche Diagnostics, Basel, Switzerland). Protein concentrations were determined by a Pierce BCA protein assay (Pierce, Rockford, IL), and 10 µg of total protein was separated by SDS-polyacrylamide gel electrophoresis on NuPage Novex Bis-Tris precast gradient gels (4–12%) (Invitrogen). Human CYP3A4 protein (BD Gentest, Woburn, MA) was used as a control. Proteins were electroblotted onto Immobilon P membranes (Millipore Corporation, Billerica, MA). After overnight blocking in 3% bovine serum albumin, the membranes were incubated with a murine monoclonal anti-human CYP3A primary antibody (1:500; BD Gentest). This antibody is known to cross-react with both CYP3A4 and CYP3A7 but not with CYP3A5. Next, the blot is incubated with a bovine anti-mouse IgG coupled to horseradish peroxidase secondary antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA). The proteins were visualized by a chemiluminescence-based detection reagent (Supersignal West Femto; Pierce), and the intensities of the CYP3A bands were determined on a Gel Doc Imaging system equipped with a XRS camera with Quantity One analysis software (Bio-Rad, Hercules, CA).
CYP3A4 Reporter Gene Assay. LS180 or HepG2 cells were seeded (2 x 105 cells/well and 5 x 105 cells/well, respectively) in 96-well plates (Greiner Bio-One BV) in 200 µl of RPMI 1640 ++ medium and incubated overnight in a 5% CO2-humidified, 37°C atmosphere. Following incubation, the cells were transfected with 75 ng/well nuclear receptor expression vector (pCDG-hPXR, pEF-hCAR, or pSG5-hVDR), 210 ng/well CYP3A4 luciferase reporter construct (pGL3-CYP3A4-XREM), and 15 ng/well renilla luciferase expression control vector (pRL-TK), using 0.99 µl/well Exgen500 in vitro transfection reagent (Fermentas) in 150 mM NaCl. In addition, to study the effect of endogenously expressed PXR, CAR, or VDR on CYP3A4 reporter activity, transfections were performed in which the nuclear receptor expression plasmids were replaced by an empty plasmid (pSG5; 75 ng/well). After overnight transfection, the medium was removed, cells were washed with PBS, and fresh medium (200 µl) containing different concentrations of the inducers rifampicin, CITCO, or calcitriol was added to the wells. Rifampicin and CITCO were dissolved in DMSO, whereas calcitriol was dissolved in ethanol. The final solvent concentration did not exceed 0.1%. After 48 h, the medium was removed, and cells were washed with PBS and lysed with 20 µl/well Passive Lysis Buffer (Promega) for 15 min on a shaker. The cell lysates (10 µl) were transferred to a white half-area 96-well plate (Corning BV, Schiphol-Rijk, The Netherlands), and the reporter activities of firefly luciferase and renilla luciferase were determined using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's manual, with reagent volumes adjusted to the cell lysate volume (Promega). Luminescence was recorded on a Mithras LB940 microplate reader (Berthold Technologies, Bad Wildbad, Germany). The -fold induction was calculated by normalization of the firefly luciferase signal to the renilla luciferase signal.
|
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
Effect of Endogenously Expressed Nuclear Receptors on CYP3A4 Reporter Activity. To evaluate the effect of endogenously expressed nuclear receptors on the CYP3A4 reporter gene activity, LS180 and HepG2 cells were transiently transfected with the CYP3A4 reporter construct and an "empty" nuclear receptor expression plasmid. The transfected cells were treated with the corresponding nuclear receptor agonists. Treatment of LS180 with 100 nM calcitriol for 48 h resulted in a major increase in CYP3A4 reporter activity (Fig. 3). In HepG2, an increase in CYP3A4 reporter gene activity was also observed after treatment with calcitriol, but it was much lower compared with the CYP3A4 reporter activity in LS180. This indicates that both cell lines express functional endogenous VDR. Exposure to rifampicin led to a small but significant (p < 0.05) increase in CYP3A4 reporter gene activity in LS180 but not in HepG2, indicating the presence of functional endogenous PXR in LS180. CITCO did not significantly increase CYP3A4 reporter activity in both LS180 and HepG2 compared with the vehicle 0.1% DMSO, which indicates that both cell lines do not express high levels of functional CAR.
|
|
2-fold) compared with the increase of CYP3A4 reporter gene activity in LS180 after treatment with the same nuclear receptor agonists. In contrast to rifampicin and calcitriol, CITCO only increased CAR-mediated CYP3A4 reporter gene activity in LS180 and not in HepG2.
Relationship between CYP3A4 Protein Expression and Reporter Gene Activity. Statistical correlation analysis revealed a significant correlation between the protein expression and CYP3A4 reporter gene data in LS180. For PXR (r2 = 0.87, n = 18, p < 0.001) and VDR (r2 = 0.86, n = 18, p < 0.001), a good correlation was found, whereas for CAR (r2 = 0.04, n = 27, p < 0.31), no correlation was found.
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
; Wilkening et al., 2003). In contrast, LS180 has been shown to express CYP3A4 (Kolars et al., 1992; Schuetz et al., 1996).
To evaluate the difference in CYP3A enzyme inducibility between HepG2 and LS180, both cells were challenged with the prototypical nuclear receptor agonists rifampicin, CITCO, or calcitriol, and mRNA and protein expression were determined. mRNA analysis of the different CYP3A enzyme expression levels in both cell lines revealed that CYP3A4 and CYP3A5 were induced after treatment with rifampicin or calcitriol in LS180, whereas none of the CYP3A mRNA enzyme levels in HepG2 were induced after treatment with these agents. Protein expression analysis showed that the expression of CYP3A protein was inducible in LS180 only. The protein levels increased after treatment with the prototypical CYP3A4 inducers rifampicin and calcitriol. Although the antibody used could not discriminate between the CYP3A4 and CYP3A7 enzymes, it can be assumed that CYP3A4 protein expression levels in this cell line were induced based on the results of the mRNA analysis, which clearly show that only CYP3A4 mRNA expression levels are inducible following treatment with these compounds.
In HepG2, CYP3A protein was hardly detectable even after treatment with rifampicin, CITCO, or calcitriol. This is consistent with the mRNA analysis data, which also show no CYP3A induction after treatment with the same compounds. Furthermore, as mentioned before, HepG2 expresses CYP3A7, which is not induced by rifampicin (Krusekopf et al., 2003; Usui et al., 2003). Krusekopf only observed pronounced CYP3A7 induction in HepG2 after treatment with typical human glucocorticoid receptor agonists indicating an important role for the human glucocorticoid receptor in CYP3A7 regulation. Furthermore, the promoter sequence of the CYP3A7 gene has two mutations in the proximal ER6 repeat, which has implications for binding of nuclear receptors of the NR1I family (e.g., PXR, CAR, VDR). These mutations lead to less pronounced binding of liganded VDR to the CYP3A7 promoter, resulting in a loss of gene activation after calcitriol treatment (Hara et al., 2004). Since PXR also recognizes and binds to ER6 repeats, the mutations may affect the binding of PXR to the CYP3A7 promoter as well, which could explain the lack of response to rifampicin treatment of HepG2 cells with respect to CYP3A7 induction.
The results discussed above clearly show that HepG2 and LS180 have distinct CYP3A induction profiles. We therefore evaluated whether this alternate expression pattern also affects CYP3A4 reporter activity. Indeed, in the CYP3A4 reporter gene assay, both cell lines clearly showed distinct responses after treatment with the prototypical nuclear receptor agonists. Treatment of LS180 and HepG2, which were transfected with CYP3A4 reporter constructs without contransfection of nuclear receptor expression plasmids, resulted in a significant (p < 0.05) increase of reporter activity after treatment with rifampicin and calcitriol in the LS180 cell line. These results indicate that functional PXR and VDR are endogenously expressed in this cell line.
The most pronounced effect on CYP3A4 reporter activity was found when both cell lines were cotransfected with the nuclear receptor expression plasmids of PXR or VDR and subsequently treated with the corresponding agonists. Comparison of the CYP3A4 reporter activities in LS180 and HepG2 cells after PXR or VDR activation revealed that there was a significant difference in the increase of CYP3A4 reporter activity between the cell lines. The -fold induction of CYP3A4 reporter activity in LS180 cells was about 2-fold higher for both nuclear receptors than the -fold induction in HepG2.
The CYP3A4 reporter activities in the presence of PXR expression plasmid in LS180 showed a good correlation with CYP3A4 protein expression levels, which in turn were in concordance with CYP3A4 protein expression levels found in primary cultures of human hepatocytes that were treated with rifampicin (Hariparsad et al., 2004). In the case of calcitriol, however, the CYP3A4 protein levels were twice as high in LS180 as in human hepatocytes (Kolars et al., 1992). This difference is probably a result of the high endogenous expression of VDR in LS180. The high endogenous VDR expression may cause problems with respect to CYP3A4 reporter gene assays that are cotransfected with other nuclear receptors such as PXR because PXR and VDR bind to the same response elements within the promoter region of the CYP3A4-luciferase construct. However, in contrast to the highly promiscuous PXR, VDR has a very narrow ligand specificity, and only bile acids and vitamin D derivatives are known to activate this receptor (Makishima et al., 2002; Hara et al., 2004). Therefore, although endogenous VDR expression is high in LS180 cells, it still is a suitable cell line to study the effect of xenobiotics on CYP3A4 induction because most compounds exert their effect on CYP3A4 expression through the more promiscuous PXR (Lehmann et al., 1998; Goodwin et al., 1999; El-Sankary et al., 2001).
In addition to PXR and VDR, CAR is also able to cross regulate CYP3A4 (Qatanani and Moore, 2005). Therefore, the role of CAR activation on the induction of CYP3A4 was investigated. CAR is, just like PXR (Squires et al., 2004) and VDR (Racz and Barsony, 1999), located in the cytoplasm in vivo. In contrast to PXR and VDR, CAR translocation is stimulated in a ligand-independent manner. Phenobarbital, phenytoin, and bilirubin have been shown to trigger CAR nuclear translocation without binding to the LBD of CAR. Due to the constitutive activity of CAR, translocation results in transcriptionally activation of its target genes. In HepG2 cells, it has been reported that CAR spontaneously translocates to the nucleus due to a lack of cytoplasmic CAR retention protein (Kobayashi et al., 2003). As a consequence, CAR transfection may automatically result in increased nuclear accumulation and enhanced transcription of its target genes (e.g., CYP3A4) in a ligand-independent manner due to its constitutive activity. This might explain the high ligand-independent CYP3A4 reporter activation in the HepG2 cell line after cotransfection with CAR. Cotransfection of CAR in the LS180 cell line also resulted in increased CYP3A4 reporter gene activity, but additional treatment with CITCO resulted in a dose-dependent increase of the CYP3A4 reporter gene activity. CITCO is the only known agonist of CAR and causes transcriptional activation as a result of direct binding to the ligand binding domain of CAR. This triggers ligand-dependent nuclear accumulation and results in increased CYP3A4 reporter gene activity. As a consequence, LS180 cells could be used to evaluate the potential of compounds to bind directly to the LBD of CAR and subsequently activate transcription in a ligand-dependent manner. Currently, however, no validated systems are available to screen compounds for their capacity to activate CAR, either ligand dependently or independently.
In conclusion, there is a clear difference in the inducible protein expression of CYP3A between both cell lines. We clearly show that HepG2 is inferior to LS180 with respect to CYP3A4 induction. The alternate CYP3A enzyme expression and gene regulation in HepG2 compromises the use of this cell line for CYP3A4 induction studies. Based on our results, we therefore recommend the use of the LS180 cell line to study CYP3A4 induction instead of the widely used HepG2.
|
Footnotes |
|---|
Article, publication date, and citation information can be found at http://dmd.aspetjournals.org.
ABBREVIATIONS: PXR, pregnane X receptor; NR, nuclear receptor; CAR, constitutive androstane receptor; VDR, vitamin D3 receptor; CITCO, 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-3,4-dichlorobenzyl) oxime; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; DMSO, dimethylsulfoxide.
Address correspondence to: Dr. S. Harmsen, Division of Biomedical Analysis, Department of Pharmaceutical Sciences, Faculty of Science, Utrecht University, Sorbonnelaan 16, 3584 CA Utrecht, The Netherlands. E-mail: s.harmsen{at}uu.nl
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  V. Chu, H. J. Einolf, R. Evers, G. Kumar, D. Moore, S. Ripp, J. Silva, V. Sinha, M. Sinz, and A. Skerjanec In Vitro and in Vivo Induction of Cytochrome P450: A Survey of the Current Practices and Recommendations: A Pharmaceutical Research and Manufacturers of America Perspective Drug Metab. Dispos., July 1, 2009; 37(7): 1339 - 1354. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
