DMD Simcyp

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Drug Metabolism and Disposition Fast Forward
First published on March 17, 2008; DOI: 10.1124/dmd.107.017335


0090-9556/08/3606-1166-1171$20.00
DMD 36:1166-1171, 2008

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dmd.107.017335v1
36/6/1166    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harmsen, S.
Right arrow Articles by Meijerman, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harmsen, S.
Right arrow Articles by Meijerman, I.

Comparison of Two Immortalized Human Cell Lines to Study Nuclear Receptor-Mediated CYP3A4 Induction

S. Harmsen, A. S. Koster, J. H. Beijnen, J. H. M. Schellens, and I. Meijerman

Divisions of Biomedical Analysis (S.H., J.H.B., J.H.M.S., I.M.) and Pharmacology and Pathophysiology (A.S.K.), Department of Pharmaceutical Sciences, Faculty of Science, Utrecht University, Utrecht, The Netherlands; Department of Pharmacy and Pharmacology, Slotervaart Hospital, Amsterdam, The Netherlands (J.H.B.); and Department of Medical Oncology, The Netherlands Cancer Institute, Amsterdam, The Netherlands (J.H.M.S.)

(Received June 21, 2007; Accepted March 14, 2008)


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Since CYP3A4 is responsible for the biotransformation of over 50% of all clinically used drugs, induction results in an increased clearance of many concomitantly administered drugs, thereby decreasing treatment efficacy or, in the case of prodrugs, lead to severe intoxications. CYP3A4 induction is regulated by the pregnane X receptor, constitutive androstane receptor, and vitamin D receptor. Since these nuclear receptors show large interspecies differences, accurate prediction of nuclear receptor-mediated CYP3A4 induction in humans requires the use of human systems. Because primary cultures of human hepatocytes or enterocytes have major drawbacks like poor availability and poor reproducibility, human cell lines are a good alternative. In this study, the widely used HepG2 cell line was compared with the LS180 cell line to serve as a model to study CYP3A4 induction. There was a clear difference between the cell lines with respect to CYP3A enzyme expression and induction. In LS180, CYP3A4 was expressed and was found to be induced by prototypical nuclear receptor agonists, whereas in HepG2, CYP3A4 was nonresponsive to treatment with rifampicin, CITCO [6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-3,4-dichlorobenzyl) oxime], or calcitriol. We subsequently evaluated whether these host-cell differences also have an effect on CYP3A4 reporter gene activity. We clearly show that there are differences in CYP3A4 reporter activity between the cell lines, and based on these results and those found on mRNA and protein level, we conclude that LS180 is a more suitable cell line to study CYP3A4 induction than the widely used HepG2.


The risk of clinically relevant drug-drug interactions that involve the highly inducible cytochrome P450 3A enzyme CYP3A4 is significant because CYP3A4 has a wide substrate specificity and is involved in the biotransformation of more than 50% of all clinically used drugs (Anzenbacher and Anzenbacherova, 2001Go). Therefore, several strategies to study CYP3A4 induction have been developed. Phenotyping studies, such as the erythromycin breath test, can be used directly to measure cytochrome P450 induction in humans. However, this method has some serious disadvantages, like the invasive administration of probe substances to humans, labor-intensive protocols, large interindividual differences, and difficulties in processing and interpreting the results. Also, the use of animals for both in vivo and in vitro studies poses problems because there are large interspecies differences in the CYP3A4 induction capacity of compounds (Lehmann et al., 1998Go). Therefore, CYP3A4 induction is mainly studied in vitro in primary cultures of human hepatocytes, which are considered to mostly resemble the in vivo situation. However, the interindividual donor variability, rapid loss of drug-metabolizing enzyme expression, poor availability, and the costs are major drawbacks (Brandon et al., 2003Go).

The finding that the highly promiscuous pregnane X receptor (PXR; NR1I2) (Moore et al., 2000Go) is one of the main regulators of CYP3A4 induction has led to the development of CYP3A4 reporter gene assays. These assays are based on the transient transfection of a cell line with a CYP3A4 reporter construct containing the response elements of PXR located in the proximal (–362/+53) and distal (–7836/–7208) promoter regions of the CYP3A4 gene linked to a firefly luciferase or other reporter genes such as alkaline phosphatase (Goodwin et al., 1999Go). In contrast to hepatocytes, many cell lines express lower levels or even no PXR (Thummel et al., 2001Go; Swales et al., 2003Go; Phillips et al., 2005Go). Therefore, cell lines used for the reporter gene assay are often cotransfected with a PXR expression plasmid to increase the levels of this nuclear receptor. Since two other nuclear receptors, the constitutive androstane receptor (CAR; NR1I3) (Kawamoto et al., 1999Go) and the vitamin D receptor (VDR; NR1I1) (Kolars et al., 1992Go), are also known to regulate CYP3A4 induction, cells can also be cotransfected with CAR or VDR instead of PXR. At the moment, cell-based reporter gene assays have become suitable alternatives to primary cultures of human hepatocytes to study nuclear receptor-mediated CYP3A4 induction. Although nuclear receptor expression levels in these reporter gene assays are raised artificially, a good correlation between PXR-mediated CYP3A4 induction measured in a reporter gene assay and CYP3A4 mRNA (Roymans et al., 2005Go) and protein (Luo et al., 2004Go) expression in primary cultures of human hepatocytes was reported. Furthermore, by comparing CYP3A4 reporter gene assay data and known data on CYP3A4 induction in vivo, Persson et al. (2006Go) showed that a CYP3A4 reporter gene assay is a reliable screening method for the assessment of drug-induced CYP3A4 expression (Persson et al., 2006Go).

Currently, the cell line most often used in CYP3A4 reporter gene assays is the human hepatocarcinoma-derived HepG2 cell line (Ogg et al., 1997Go, 1999Go; El-Sankary et al., 2001Go; Luo et al., 2004Go; Trubetskoy et al., 2005Go; Noracharttiyapot et al., 2006Go; Sinz et al., 2006Go; Huang et al., 2007Go). However, HepG2 mainly expresses the fetal enzyme CYP3A7 instead of CYP3A4 (Schuetz et al., 1993Go). In addition, despite the presence of endogenous PXR, CYP3A4 expression is not enhanced by rifampicin treatment in HepG2 cells (Ogino et al., 2002Go). Since CYP3A4 is also present in the gastrointestinal tract and has been shown to contribute significantly to the prehepatic metabolism of drugs (Kolars et al., 1992Go), other groups use the human colon carcinoma-derived LS180 cell line as a host for their CYP3A4 reporter gene assay (Synold et al., 2001Go; Zhou et al., 2004Go). In contrast to HepG2, rifampicin was shown to increase CYP3A4 expression in LS180 cells (Schuetz et al., 1996Go) Moreover, in a comparison among three colon carcinoma cell lines (LS180, CaCo-2, and TC-7), only LS180 showed inducible CYP3A4 expression (Pfrunder et al., 2003Go).

The aim of this study was to investigate the suitability of LS180 cells as a model to study CYP3A4 induction in comparison with the widely used HepG2 cell line. Therefore, CYP3A mRNA and protein expression levels in both cell lines were determined after treatment with prototypical nuclear receptor agonists [rifampicin (PXR), CITCO (CAR), calcitriol (VDR)] that are known inducers of CYP3A4. Furthermore, the use of these cell lines as hosts for CYP3A4 reporter gene assays was evaluated.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Materials. All cell culture media and supplements were purchased from Invitrogen (Carlsbad, CA). CITCO (purity, >98%) was obtained from BIOMOL Research Laboratories (Plymouth Meeting, PA). All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO).

Plasmids. The pGL3-CYP3A4-XREM (proximal, –362/+53; distal, –7836/–7208) luciferase reporter construct and the pEF-hCAR expression plasmid were kind gifts from Dr. Richard Kim (Vanderbilt University, Nashville, TN), the pCDG-hPXR expression vector was generously provided by Dr. Ron Evans (The Howard Hughes Medical Institute, La Jolla, CA), the pSG5-hVDR expression plasmid was kindly donated by Dr. Bandana Chatterjee (Department of Molecular Medicine/Institute of Biotechnology, University of Texas Health Science Centre, San Antonio, TX), and the pRL-TK control plasmid was obtained from Promega (Madison, WI). Plasmids were checked by enzyme restriction and agarose gel electrophoresis and purified using Promega's Pureyield Midi-prep according to the instructions of the manufacturer.

Cell Culture. The human colon adenocarcinoma-derived cell line, LS180 (used between passages 12 and 14), and the human hepatoma-derived cell line, HepG2 (used between passages 13 and 15) were purchased from the American Type Culture Collection (Manassas, VA). The cell lines were maintained in RPMI 1640 ++ medium [with 25 mM HEPES and L-glutamine, supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin] at 37°C under a humidified atmosphere of 5% CO2.

Treatment. HepG2 and LS180 cells were plated at a density of 1 x 106 cells/well in six-well plates (Greiner Bio-One BV, Alphen a/d Rijn, The Netherlands) in 2 ml of RPMI 1640 medium++. After reaching 80 to 90% confluency, medium was replaced with medium containing different concentrations of rifampicin (1 or 10 µM), CITCO (10 or 250 nM), or calcitriol (1 or 100 nM) and refreshed after 24 h. The final solvent concentrations did not exceed 0.1%. After 48 h, cells were washed with phosphate-buffered saline (PBS). The cells were further used for immunoblot analysis or quantitative polymerase chain reaction as described below.

RNA Extraction and Reverse Transcription-PCR. Total RNA was extracted using the GeneElute Mammalian total RNA miniprep kit (Sigma-Aldrich). RNA integrity and quantity were determined using a Nanodrop Diode Array Spectrophotometer (Isogen Life Science, Ijsselstein, The Netherlands). One microgram of total RNA was reverse transcribed according to the manufacturer guidelines concerning the random hexamer primer (RevertAid First Strand cDNA synthesis kit; Fermentas, St. Leon-Rot, Germany).

Quantitative Reverse Transcription-PCR. The CYP3A4, CYP3A5, CYP3A7, and 18S mRNA expression levels were analyzed using an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA). All reactions were singleplexed with 18S. Oligonucleotide primers and a Taqman probe for CYP3A4 were as follows: forward, TCAATAACAGTCTTTCCATTCCTCAT; reverse, CTTCGAGGCGACTTTCTTTCA; and probe, TGTTTCCAAGAGAAGTTACAAA. The primers and probe used for 18S, CYP3A5 (Hs00241417_m1), and CYP3A7 (Hs00426361_m1) real-time PCR were commercially available Assay on Demand kits (Applied Biosystems). According to manufacturer guidelines, data were expressed as threshold cycle value (ct) and used to determine dct values. -Fold changes in expression were calculated according to the following transformation: -fold increase = 2–(difference in delta ct).

Immunoblot Analysis. After 48 h, cells were harvested and lysed in 250 µl of PBS containing 1% Triton X-100, 0.1% SDS, 1 mM dithiothreitol, and 1% protease inhibitor cocktail tablet (Roche Diagnostics, Basel, Switzerland). Protein concentrations were determined by a Pierce BCA protein assay (Pierce, Rockford, IL), and 10 µg of total protein was separated by SDS-polyacrylamide gel electrophoresis on NuPage Novex Bis-Tris precast gradient gels (4–12%) (Invitrogen). Human CYP3A4 protein (BD Gentest, Woburn, MA) was used as a control. Proteins were electroblotted onto Immobilon P membranes (Millipore Corporation, Billerica, MA). After overnight blocking in 3% bovine serum albumin, the membranes were incubated with a murine monoclonal anti-human CYP3A primary antibody (1:500; BD Gentest). This antibody is known to cross-react with both CYP3A4 and CYP3A7 but not with CYP3A5. Next, the blot is incubated with a bovine anti-mouse IgG coupled to horseradish peroxidase secondary antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA). The proteins were visualized by a chemiluminescence-based detection reagent (Supersignal West Femto; Pierce), and the intensities of the CYP3A bands were determined on a Gel Doc Imaging system equipped with a XRS camera with Quantity One analysis software (Bio-Rad, Hercules, CA).

CYP3A4 Reporter Gene Assay. LS180 or HepG2 cells were seeded (2 x 105 cells/well and 5 x 105 cells/well, respectively) in 96-well plates (Greiner Bio-One BV) in 200 µl of RPMI 1640 ++ medium and incubated overnight in a 5% CO2-humidified, 37°C atmosphere. Following incubation, the cells were transfected with 75 ng/well nuclear receptor expression vector (pCDG-hPXR, pEF-hCAR, or pSG5-hVDR), 210 ng/well CYP3A4 luciferase reporter construct (pGL3-CYP3A4-XREM), and 15 ng/well renilla luciferase expression control vector (pRL-TK), using 0.99 µl/well Exgen500 in vitro transfection reagent (Fermentas) in 150 mM NaCl. In addition, to study the effect of endogenously expressed PXR, CAR, or VDR on CYP3A4 reporter activity, transfections were performed in which the nuclear receptor expression plasmids were replaced by an empty plasmid (pSG5; 75 ng/well). After overnight transfection, the medium was removed, cells were washed with PBS, and fresh medium (200 µl) containing different concentrations of the inducers rifampicin, CITCO, or calcitriol was added to the wells. Rifampicin and CITCO were dissolved in DMSO, whereas calcitriol was dissolved in ethanol. The final solvent concentration did not exceed 0.1%. After 48 h, the medium was removed, and cells were washed with PBS and lysed with 20 µl/well Passive Lysis Buffer (Promega) for 15 min on a shaker. The cell lysates (10 µl) were transferred to a white half-area 96-well plate (Corning BV, Schiphol-Rijk, The Netherlands), and the reporter activities of firefly luciferase and renilla luciferase were determined using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's manual, with reagent volumes adjusted to the cell lysate volume (Promega). Luminescence was recorded on a Mithras LB940 microplate reader (Berthold Technologies, Bad Wildbad, Germany). The -fold induction was calculated by normalization of the firefly luciferase signal to the renilla luciferase signal.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 1. Inducible expression of CYP3A enzymes in HepG2 and LS180. The inducibility of the different CYP3A enzyme mRNA levels were determined after 2 x 24-h treatment of the cells with 0.1% DMSO, rifampicin (1 and 10 µM), CITCO (10 and 250 nM), and calcitriol (1 and 100 nM). Total RNA was isolated and converted to cDNA, which was assessed at least in triplicate using singleplexed quantitative Taqman real-time PCR (CYP3A4, CYP3A5, CYP3A7) and normalized to 18S. The results are expressed as -fold induction over the control (0.1% DMSO/ethanol). Statistical analysis on real-time PCR data were performed on mean dct values (and not -fold changes) to exclude potential bias attributable to averaging data that had been transformed through the equation 2–ct (Quinkler et al., 2005Go) (significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001).

 
Statistical Analysis. Data were analyzed by using one-way analysis of variance, and the means were compared by applying the Bonferroni post hoc test and were considered statistically significant when p < 0.05. The correlation between the data obtained from the CYP3A4 reporter gene assays, and the protein expression levels were determined using the Pearson correlation coefficient. All statistical determinations were performed with SPSS version 14 (SPSS Inc., Chicago, IL).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Inducible Expression of CYP3A mRNA in LS180 and HepG2. First, we considered which CYP3A enzymes are induced following treatment with rifampicin, CITCO, and calcitriol in LS180 and HepG2. As shown in Fig. 1, in LS180, a significant increase of CYP3A4 mRNA expression was observed after exposure to rifampicin and calcitriol, whereas a less marked induction of CYP3A5 mRNA expression was observed following treatment with these compounds. CITCO however did not affect CYP3A4, CYP3A5, or CYP3A7 mRNA expression in LS180. In HepG2, no significant increase in CYP3A mRNA expression was detected after exposure to rifampicin, CITCO, or calcitriol.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 2. CYP3A induction in LS180 after treatment with prototypical nuclear receptor agonists. Proteins (10 µg) were separated using SDS-PAGE, transferred to Immobilon P membrane, and probed with mouse-anti-human CYP3A4/7 antibody. Blots were subjected to densitometric analysis. The level of induction is expressed as an increase in CYP3A protein levels. The results are derived from a representative experiment, and data are the means ± S.D. from three separate determinations and are expressed as the relative induction compared with the vehicle (significance: *, p < 0.05).

 
Inducible Expression of CYP3A Protein in LS180 and HepG2. The CYP3A protein response profile after exposure to rifampicin, CITCO, or calcitriol was examined in LS180 and HepG2 using Western immunoblotting. As shown in Fig. 2, inducible expression of CYP3A protein was detected after exposure to rifampicin and calcitriol in LS180. CITCO did not increase CYP3A protein expression in LS180 cells. In HepG2, the protein expression of CYP3A was very low and was not induced after treatment with the prototypical nuclear receptor agonists rifampicin, CITCO, and calcitriol (data not shown).

Effect of Endogenously Expressed Nuclear Receptors on CYP3A4 Reporter Activity. To evaluate the effect of endogenously expressed nuclear receptors on the CYP3A4 reporter gene activity, LS180 and HepG2 cells were transiently transfected with the CYP3A4 reporter construct and an "empty" nuclear receptor expression plasmid. The transfected cells were treated with the corresponding nuclear receptor agonists. Treatment of LS180 with 100 nM calcitriol for 48 h resulted in a major increase in CYP3A4 reporter activity (Fig. 3). In HepG2, an increase in CYP3A4 reporter gene activity was also observed after treatment with calcitriol, but it was much lower compared with the CYP3A4 reporter activity in LS180. This indicates that both cell lines express functional endogenous VDR. Exposure to rifampicin led to a small but significant (p < 0.05) increase in CYP3A4 reporter gene activity in LS180 but not in HepG2, indicating the presence of functional endogenous PXR in LS180. CITCO did not significantly increase CYP3A4 reporter activity in both LS180 and HepG2 compared with the vehicle 0.1% DMSO, which indicates that both cell lines do not express high levels of functional CAR.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 3. Effect of endogenous nuclear receptor expression on CYP3A4 reporter activity. LS180 and HepG2 cells were transfected with the CYP3A4-reporter construct and an empty nuclear receptor expression plasmid. Cells were treated for 48 h with the nuclear receptor agonists rifampicin (RIF; 10 µM), CITCO (250 nM), or calcitriol (CAL; 100 nM). Calcitriol induced CYP3A4 reporter activity only in LS180, which indicates that LS180 expresses high endogenous levels of VDR (significance: *, p < 0.05).

 
CYP3A4 Reporter Gene Activity in LS180 and HepG2. To examine the influence of the host cell line on the activity of the CYP3A4 reporter gene assay in the presence of exogenous PXR, CAR, or VDR, LS180 and HepG2 were transiently transfected with the CYP3A4 reporter construct combined with PXR, CAR, or VDR expression plasmids, followed by exposure to different concentrations of the corresponding agonists. The CYP3A4 reporter activities in both LS180 and HepG2 as a result of nuclear receptor activation are shown in Fig. 4.


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 4. Differential response in CYP3A4 reporter activity upon activation of three distinct nuclear receptors in LS180 and HepG2. LS180 and HepG2 cells (2 x 105 cells/ml and 5 x 105 cells/well, respectively) were transfected with the pGL3-CYP3A4-XREM reporter construct, and the nuclear receptor expression vectors pCDG-hPXR, pEF-hCAR, or pSG5-hVDR and the pRL-TK control vector. After 24 h of transfection, cells were exposed to the corresponding nuclear receptor agonists serially diluted in DMSO (rifampicin, 1, 5, 10, 25 µM; CITCO, 10, 50, 100, 250 nM; calcitriol, 1, 10, 50, 100 nM) with a final solvent concentration of 0.1%. After 48 h, luciferase activity was measured. These results are derived from a representative experiment, and data are the means ± S.D. from three separate determinations and expressed as absolute reporter activity (significance: *, p < 0.05).

 
In LS180, rifampicin, CITCO, and calcitriol were able to significantly increase CYP3A4 reporter gene activity compared with the control, whereas in HepG2, only rifampicin and calcitriol gave a significant increase in CYP3A4 reporter gene activity compared with the control. Moreover, the increase of PXR- and VDR-mediated CYP3A4 reporter activity following treatment with rifampicin and calcitriol, respectively, in HepG2 was significantly lower (~2-fold) compared with the increase of CYP3A4 reporter gene activity in LS180 after treatment with the same nuclear receptor agonists. In contrast to rifampicin and calcitriol, CITCO only increased CAR-mediated CYP3A4 reporter gene activity in LS180 and not in HepG2.

Relationship between CYP3A4 Protein Expression and Reporter Gene Activity. Statistical correlation analysis revealed a significant correlation between the protein expression and CYP3A4 reporter gene data in LS180. For PXR (r2 = 0.87, n = 18, p < 0.001) and VDR (r2 = 0.86, n = 18, p < 0.001), a good correlation was found, whereas for CAR (r2 = 0.04, n = 27, p < 0.31), no correlation was found.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we explored the suitability of the colon carcinoma-derived LS180 cell line for its use in CYP3A4 induction studies compared with the hepatoma-derived HepG2 cell line. HepG2 is still the most widely used cell line in CYP3A regulation and induction studies, although several groups have already shown that the HepG2 cell line expresses high levels of the fetal CYP3A enzyme CYP3A7 (Schuetz et al., 1993Go; Wilkening et al., 2003Go). In contrast, LS180 has been shown to express CYP3A4 (Kolars et al., 1992Go; Schuetz et al., 1996Go).

To evaluate the difference in CYP3A enzyme inducibility between HepG2 and LS180, both cells were challenged with the prototypical nuclear receptor agonists rifampicin, CITCO, or calcitriol, and mRNA and protein expression were determined. mRNA analysis of the different CYP3A enzyme expression levels in both cell lines revealed that CYP3A4 and CYP3A5 were induced after treatment with rifampicin or calcitriol in LS180, whereas none of the CYP3A mRNA enzyme levels in HepG2 were induced after treatment with these agents. Protein expression analysis showed that the expression of CYP3A protein was inducible in LS180 only. The protein levels increased after treatment with the prototypical CYP3A4 inducers rifampicin and calcitriol. Although the antibody used could not discriminate between the CYP3A4 and CYP3A7 enzymes, it can be assumed that CYP3A4 protein expression levels in this cell line were induced based on the results of the mRNA analysis, which clearly show that only CYP3A4 mRNA expression levels are inducible following treatment with these compounds.

In HepG2, CYP3A protein was hardly detectable even after treatment with rifampicin, CITCO, or calcitriol. This is consistent with the mRNA analysis data, which also show no CYP3A induction after treatment with the same compounds. Furthermore, as mentioned before, HepG2 expresses CYP3A7, which is not induced by rifampicin (Krusekopf et al., 2003Go; Usui et al., 2003Go). Krusekopf only observed pronounced CYP3A7 induction in HepG2 after treatment with typical human glucocorticoid receptor agonists indicating an important role for the human glucocorticoid receptor in CYP3A7 regulation. Furthermore, the promoter sequence of the CYP3A7 gene has two mutations in the proximal ER6 repeat, which has implications for binding of nuclear receptors of the NR1I family (e.g., PXR, CAR, VDR). These mutations lead to less pronounced binding of liganded VDR to the CYP3A7 promoter, resulting in a loss of gene activation after calcitriol treatment (Hara et al., 2004Go). Since PXR also recognizes and binds to ER6 repeats, the mutations may affect the binding of PXR to the CYP3A7 promoter as well, which could explain the lack of response to rifampicin treatment of HepG2 cells with respect to CYP3A7 induction.

The results discussed above clearly show that HepG2 and LS180 have distinct CYP3A induction profiles. We therefore evaluated whether this alternate expression pattern also affects CYP3A4 reporter activity. Indeed, in the CYP3A4 reporter gene assay, both cell lines clearly showed distinct responses after treatment with the prototypical nuclear receptor agonists. Treatment of LS180 and HepG2, which were transfected with CYP3A4 reporter constructs without contransfection of nuclear receptor expression plasmids, resulted in a significant (p < 0.05) increase of reporter activity after treatment with rifampicin and calcitriol in the LS180 cell line. These results indicate that functional PXR and VDR are endogenously expressed in this cell line.

The most pronounced effect on CYP3A4 reporter activity was found when both cell lines were cotransfected with the nuclear receptor expression plasmids of PXR or VDR and subsequently treated with the corresponding agonists. Comparison of the CYP3A4 reporter activities in LS180 and HepG2 cells after PXR or VDR activation revealed that there was a significant difference in the increase of CYP3A4 reporter activity between the cell lines. The -fold induction of CYP3A4 reporter activity in LS180 cells was about 2-fold higher for both nuclear receptors than the -fold induction in HepG2.

The CYP3A4 reporter activities in the presence of PXR expression plasmid in LS180 showed a good correlation with CYP3A4 protein expression levels, which in turn were in concordance with CYP3A4 protein expression levels found in primary cultures of human hepatocytes that were treated with rifampicin (Hariparsad et al., 2004Go). In the case of calcitriol, however, the CYP3A4 protein levels were twice as high in LS180 as in human hepatocytes (Kolars et al., 1992Go). This difference is probably a result of the high endogenous expression of VDR in LS180. The high endogenous VDR expression may cause problems with respect to CYP3A4 reporter gene assays that are cotransfected with other nuclear receptors such as PXR because PXR and VDR bind to the same response elements within the promoter region of the CYP3A4-luciferase construct. However, in contrast to the highly promiscuous PXR, VDR has a very narrow ligand specificity, and only bile acids and vitamin D derivatives are known to activate this receptor (Makishima et al., 2002Go; Hara et al., 2004Go). Therefore, although endogenous VDR expression is high in LS180 cells, it still is a suitable cell line to study the effect of xenobiotics on CYP3A4 induction because most compounds exert their effect on CYP3A4 expression through the more promiscuous PXR (Lehmann et al., 1998Go; Goodwin et al., 1999Go; El-Sankary et al., 2001Go).

In addition to PXR and VDR, CAR is also able to cross regulate CYP3A4 (Qatanani and Moore, 2005Go). Therefore, the role of CAR activation on the induction of CYP3A4 was investigated. CAR is, just like PXR (Squires et al., 2004Go) and VDR (Racz and Barsony, 1999Go), located in the cytoplasm in vivo. In contrast to PXR and VDR, CAR translocation is stimulated in a ligand-independent manner. Phenobarbital, phenytoin, and bilirubin have been shown to trigger CAR nuclear translocation without binding to the LBD of CAR. Due to the constitutive activity of CAR, translocation results in transcriptionally activation of its target genes. In HepG2 cells, it has been reported that CAR spontaneously translocates to the nucleus due to a lack of cytoplasmic CAR retention protein (Kobayashi et al., 2003Go). As a consequence, CAR transfection may automatically result in increased nuclear accumulation and enhanced transcription of its target genes (e.g., CYP3A4) in a ligand-independent manner due to its constitutive activity. This might explain the high ligand-independent CYP3A4 reporter activation in the HepG2 cell line after cotransfection with CAR. Cotransfection of CAR in the LS180 cell line also resulted in increased CYP3A4 reporter gene activity, but additional treatment with CITCO resulted in a dose-dependent increase of the CYP3A4 reporter gene activity. CITCO is the only known agonist of CAR and causes transcriptional activation as a result of direct binding to the ligand binding domain of CAR. This triggers ligand-dependent nuclear accumulation and results in increased CYP3A4 reporter gene activity. As a consequence, LS180 cells could be used to evaluate the potential of compounds to bind directly to the LBD of CAR and subsequently activate transcription in a ligand-dependent manner. Currently, however, no validated systems are available to screen compounds for their capacity to activate CAR, either ligand dependently or independently.

In conclusion, there is a clear difference in the inducible protein expression of CYP3A between both cell lines. We clearly show that HepG2 is inferior to LS180 with respect to CYP3A4 induction. The alternate CYP3A enzyme expression and gene regulation in HepG2 compromises the use of this cell line for CYP3A4 induction studies. Based on our results, we therefore recommend the use of the LS180 cell line to study CYP3A4 induction instead of the widely used HepG2.


    Footnotes
 
This study was supported by the Maurits and Anna de Kock Foundation and by the Nijbakker-Morra Foundation.

Article, publication date, and citation information can be found at http://dmd.aspetjournals.org.

doi:10.1124/dmd.107.017335.

ABBREVIATIONS: PXR, pregnane X receptor; NR, nuclear receptor; CAR, constitutive androstane receptor; VDR, vitamin D3 receptor; CITCO, 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-3,4-dichlorobenzyl) oxime; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; DMSO, dimethylsulfoxide.

Address correspondence to: Dr. S. Harmsen, Division of Biomedical Analysis, Department of Pharmaceutical Sciences, Faculty of Science, Utrecht University, Sorbonnelaan 16, 3584 CA Utrecht, The Netherlands. E-mail: s.harmsen{at}uu.nl


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 


Anzenbacher P and Anzenbacherova E (2001) Cytochromes P450 and metabolism of xenobiotics. Cell Mol Life Sci 58: 737–747.[CrossRef][Medline]

Brandon EF, Raap CD, Meijerman I, Beijnen JH, and Schellens JH (2003) An update on in vitro test methods in human hepatic drug biotransformation research: pros and cons. Toxicol Appl Pharmacol 189: 233–246.[CrossRef][Medline]

El-Sankary W, Gibson GG, Ayrton A, and Plant N (2001) Use of a reporter gene assay to predict and rank the potency and efficacy of CYP3A4 inducers. Drug Metab Dispos 29: 1499–1504.[Abstract/Free Full Text]

Goodwin B, Hodgson E, and Liddle C (1999) The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol Pharmacol 56: 1329–1339.[Abstract/Free Full Text]

Hara H, Yasunami Y, and Adachi T (2004) Loss of CYP3A7 gene induction by 1,25-dihydroxyvitamin D3 is caused by less binding of VDR to the proximal ER6 in CYP3A7 gene. Biochem Biophys Res Commun 321: 909–915.[CrossRef][Medline]

Hariparsad N, Nallani SC, Sane RS, Buckley DJ, Buckley AR, and Desai PB (2004) Induction of CYP3A4 by efavirenz in primary human hepatocytes: comparison with rifampin and phenobarbital. J Clin Pharmacol 44: 1273–1281.[Abstract/Free Full Text]

Huang H, Wang H, Sinz M, Zoeckler M, Staudinger J, Redinbo MR, Teotico DG, Locker J, Kalpana GV, and Mani S (2007) Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene 26: 258–268.[CrossRef][Medline]

Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washburn K, and Negishi M (1999) Phenobarbital-responsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol Cell Biol 19: 6318–6322.[Abstract/Free Full Text]

Kobayashi K, Sueyoshi T, Inoue K, Moore R, and Negishi M (2003) Cytoplasmic accumulation of the nuclear receptor CAR by a tetratricopeptide repeat protein in HepG2 cells. Mol Pharmacol 64: 1069–1075.[Abstract/Free Full Text]

Kolars JC, Schmiedlin-Ren P, Schuetz JD, Fang C, and Watkins PB (1992) Identification of rifampin-inducible P450IIIA4 (CYP3A4) in human small bowel enterocytes. J Clin Invest 90: 1871–1878.[Medline]

Krusekopf S, Roots I, and Kleeberg U (2003) Differential drug-induced mRNA expression of human CYP3A4 compared to CYP3A5, CYP3A7 and CYP3A43. Eur J Pharmacol 466: 7–12.[CrossRef][Medline]

Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, and Kliewer SA (1998) The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest 102: 1016–1023.[Medline]

Luo G, Guenthner T, Gan LS, and Humphreys WG (2004) CYP3A4 induction by xenobiotics: biochemistry, experimental methods and impact on drug discovery and development. Curr Drug Metab 5: 483–505.[CrossRef][Medline]

Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM, Haussler MR, and Mangelsdorf DJ (2002) Vitamin D receptor as an intestinal bile acid sensor. Science 296: 1313–1316.[Abstract/Free Full Text]

Moore LB, Parks DJ, Jones SA, Bledsoe RK, Consler TG, Stimmel JB, Goodwin B, Liddle C, Blanchard SG, Willson TM, et al. (2000) Orphan nuclear receptors constitutive androstane receptor and pregnane X receptor share xenobiotic and steroid ligands. J Biol Chem 275: 15122–15127.[Abstract/Free Full Text]

Noracharttiyapot W, Nagai Y, Matsubara T, Miyata M, Shimada M, Nagata K, and Yamazoe Y (2006) Construction of several human-derived stable cell lines displaying distinct profiles of CYP3A4 induction. Drug Metab Pharmacokinet 21: 99–108.[CrossRef][Medline]

Ogg MS, Gray TJ, and Gibson GG (1997) Development of an in vitro reporter gene assay to assess xenobiotic induction of the human CYP3A4 gene. Eur J Drug Metab Pharmacokinet 22: 311–313.[Medline]

Ogg MS, Williams JM, Tarbit M, Goldfarb PS, Gray TJ, and Gibson GG (1999) A reporter gene assay to assess the molecular mechanisms of xenobiotic-dependent induction of the human CYP3A4 gene in vitro. Xenobiotica 29: 269–279.[CrossRef][Medline]

Ogino M, Nagata K, and Yamazoe Y (2002) Selective suppressions of human CYP3A forms, CYP3A5 and CYP3A7, by troglitazone in HepG2 cells. Drug Metab Pharmacokinet 17: 42–46.[CrossRef][Medline]

Persson KP, Ekehed S, Otter C, Lutz ES, McPheat J, Masimirembwa CM, and Andersson TB (2006) Evaluation of human liver slices and reporter gene assays as systems for predicting the cytochrome P450 induction potential of drugs in vivo in humans. Pharmacol Res 23: 56–69.[CrossRef]

Pfrunder A, Gutmann H, Beglinger C, and Drewe J (2003) Gene expression of CYP3A4, ABC-transporters (MDR1 and MRP1-MRP5) and hPXR in three different human colon carcinoma cell lines. J Pharm Pharmacol 55: 59–66.[Medline]

Phillips A, Hood SR, Gibson GG, and Plant NJ (2005) Impact of transcription factor profile and chromatin conformation on human hepatocyte CYP3A gene expression. Drug Metab Dispos 33: 233–242.[Abstract/Free Full Text]

Qatanani M and Moore DD (2005) CAR, the continuously advancing receptor, in drug metabolism and disease. Curr Drug Metab 6: 329–339.[CrossRef][Medline]

Quinkler M, Bujalska IJ, Kaur K, Onyimba CU, Buhner S, Allolio B, Hughes SV, Hewison M, and Stewart PM (2005) Androgen receptor-mediated regulation of the alpha-subunit of the epithelial sodium channel in human kidney. Hypertension 46: 787–798.[Abstract/Free Full Text]

Racz A and Barsony J (1999) Hormone-dependent translocation of vitamin D receptors is linked to transactivation. J Biol Chem 274: 19352–19360.[Abstract/Free Full Text]

Roymans D, Annaert P, Van Houdt J, Weygers A, Noukens J, Sensenhauser C, Silva J, Van Looveren C, Hendrickx J, Mannens G, et al. (2005) Expression and induction potential of cytochromes P450 in human cryopreserved hepatocytes. Drug Metab Dispos 33: 1004–1016.[Abstract/Free Full Text]

Schuetz EG, Beck WT, and Schuetz JD (1996) Modulators and substrates of P-glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol Pharmacol 49: 311–318.[Abstract]

Schuetz EG, Schuetz JD, Strom SC, Thompson MT, Fisher RA, Molowa DT, Li D, and Guzelian PS (1993) Regulation of human liver cytochromes P-450 in family 3A in primary and continuous culture of human hepatocytes. Hepatology 18: 1254–1262.[CrossRef][Medline]

Sinz M, Kim S, Zhu Z, Chen T, Anthony M, Dickinson K, and Rodrigues AD (2006) Evaluation of 170 xenobiotics as transactivators of human pregnane X receptor (hPXR) and correlation to known CYP3A4 drug interactions. Curr Drug Metab 7: 375–388.[CrossRef][Medline]

Squires EJ, Sueyoshi T, and Negishi M (2004) Cytoplasmic localization of pregnane X receptor and ligand-dependent nuclear translocation in mouse liver. J Biol Chem 279: 49307–49314.[Abstract/Free Full Text]

Swales K, Plant N, Ayrton A, Hood S, and Gibson G (2003) Relative receptor expression is a determinant in xenobiotic-mediated CYP3A induction in rat and human cells. Xenobiotica 33: 703–716.[CrossRef][Medline]

Synold TW, Dussault I, and Forman BM (2001) The orphan nuclear receptor SXR coordinately regulates drug metabolism and efflux. Nat Med 7: 584–590.[CrossRef][Medline]

Thummel KE, Brimer C, Yasuda K, Thottassery J, Senn T, Lin Y, Ishizuka H, Kharasch E, Schuetz J, and Schuetz E (2001) Transcriptional control of intestinal cytochrome P-4503A by 1alpha,25-dihydroxy vitamin D3. Mol Pharmacol 60: 1399–1406.[Abstract/Free Full Text]

Trubetskoy O, Marks B, Zielinski T, Yueh MF, and Raucy J (2005) A simultaneous assessment of CYP3A4 metabolism and induction in the DPX-2 cell line. AAPS J 7: E6–E13.[CrossRef][Medline]

Usui T, Saitoh Y, and Komada F (2003) Induction of CYP3As in HepG2 cells by several drugs: association between induction of CYP3A4 and expression of glucocorticoid receptor. Biol Pharm Bull 26: 510–517.[CrossRef][Medline]

Wilkening S, Stahl F, and Bader A (2003) Comparison of primary human hepatocytes and hepatoma cell line Hepg2 with regard to their biotransformation properties. Drug Metab Dispos 31: 1035–1042.[Abstract/Free Full Text]

Zhou C, Tabb MM, Sadatrafiei A, Grun F, and Blumberg B (2004) Tocotrienols activate the steroid and xenobiotic receptor, SXR, and selectively regulate expression of its target genes. Drug Metab Dispos 32: 1075–1082.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
V. Chu, H. J. Einolf, R. Evers, G. Kumar, D. Moore, S. Ripp, J. Silva, V. Sinha, M. Sinz, and A. Skerjanec
In Vitro and in Vivo Induction of Cytochrome P450: A Survey of the Current Practices and Recommendations: A Pharmaceutical Research and Manufacturers of America Perspective
Drug Metab. Dispos., July 1, 2009; 37(7): 1339 - 1354.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dmd.107.017335v1
36/6/1166    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harmsen, S.
Right arrow Articles by Meijerman, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harmsen, S.
Right arrow Articles by Meijerman, I.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition