TABLE 1

Primers used in this study


Primer

Sequence
Forward flanking primer for R97 5′ CATCGATGCTTAGGAGGTCATATGGCTCGACAATC 3′
Reverse flanking primer for R97 5′ TTTTCTCAACTCCTCCACAAGGCAGCGGGC 3′
Forward R97 mutagenic primer 5′ GATCTTGGAGAGGAATTCTCTGGAVHAGGCATTTTCCCACTG 3′
Reverse R97 mutagenic primer 5′ CAGTGGGAAAATGCCTDBTCCAGAGAATTCCTCTCCAAGATC 3′
Forward flanking primer for K72 5′ GATGCTTAGGAGGTCATATGGCTCGACAA 3′
Reverse flanking primer for K72 5′ AGGGTTGTGCTTGTCGTCTCTGTCCCAGC 3′
Forward K72 mutagenic primer 5′ CTCTGTATTTTGGCCTCVWKCCCATAGTGGTGCTCCATGGATATGAAGC 3′
Reverse K72 mutagenic primer
5′ GCTTCATATCCATGGAGCACCACTATGGGMWBGAGGCCAAAATACAGAG 3′