TABLE 2

Oligonucleotide probes generated for analysis of mouse Oatp mRNA expression by QuantiGene branched DNA signal amplification assay


Name

Target Region

Function

Sequence
Oatp1a1 1279-1307 CE agtgatcttaaacttcttcataataaagcTTTTTctcttggaaagaaagt
1308-1331 CE tgctatgtatgcagctttcttgacTTTTTctcttggaaagaaagt
1431-1452 CE ccccatatagagggtgctgaacTTTTTctcttggaaagaaagt
1476-1497 CE ttaagcagctgcaccttgtgttTTTTTctcttggaaagaaagt
1603-1622 CE cccaatgcagctgcaattttTTTTTctcttggaaagaaagt
1623-1646 CE gactgcagatgagtttcctgatgaTTTTTctcttggaaagaaagt
1228-1252 LE ggaggcaagctataaacacctatgaTTTTTaggcataggacccgtgtct
1253-1278 LE cactgattaaatatccaaggcatactTTTTTaggcataggacccgtgtct
1332-1354 LE tattcagataaggacaggccaaaTTTTTaggcataggacccgtgtct
1406-1430 LE tcctttataagaggtggttaatccaTTTTTaggcataggacccgtgtct
1453-1475 LE gcagtcagcaaggacatttttctTTTTTaggcataggacccgtgtct
1498-1517 LE cactggatcccatgtgtccgTTTTTaggcataggacccgtgtct
1518-1537 LE gctaggccattgtccccacaTTTTTaggcataggacccgtgtct
1538-1557 LE cgaggcaggctgacatgtaaTTTTTaggcataggacccgtgtct
1558-1579 LE ccaacagacttctcacagcctgTTTTTaggcataggacccgtgtct
1647-1667 LE gcctttcttacacagccccagTTTTTaggcataggacccgtgtct
1668-1689 LE gcagcttgttgtcacactcaggTTTTTaggcataggacccgtgtct
1355-1383 BL tcaacaaatagttacagagaaaaataaaa
1384-1405 BL gcaactgggaaattatcacagg
1580-1602 BL gaaacaccatgttggttccagtt
Oatp1a4 526-545 CE gcctgtgcagttttgttccgTTTTTctcttggaaagaaagt
591-616 CE gaggaaatgaggtatcgatattaagaTTTTTctcttggaaagaaagt
715-735 CE cactctgttgggtcttgcgttTTTTTctcttggaaagaaagt
452-474 LE ttgataagcccaactacagacgtTTTTTaggcataggacccgtgtct
546-570 LE gcacatcctacaccaatcatgatagTTTTTaggcataggacccgtgtct
667-690 LE tccgtacacacaaagctatttgagTTTTTaggcataggacccgtgtct
793-812 LE tgggagtttcacccattccaTTTTTaggcataggacccgtgtct
833-858 LE tcagattttgcaaaatcttctatgtaTTTTTaggcataggacccgtgtct
886-907 LE gccaatggtcattcctgtttctTTTTTaggcataggacccgtgtct
859-885 BL aaaatcccaatatataaaggagagttt
475-497 BL gatttcctatctcaaagctccca
498-525 BL aagtaactcacgaatataatcaacagaa
571-590 BL aacaccccaggcccataact
617-640 BL tgtttcatattcatatctgcccat
641-666 BL gacaagttgcttgtaggtaaaattgt
691-714 BL ggctttaaggtctgtgttctgttt
736-762 BL cacattaatgatttcatttctttcaca
763-792 BL cgtataatgtttcctaccagtacatatatc
813-832 BL ggaaatacccaagggcatga
Oatp1a5 95-118 CE aatccttttctctgtttctcccatTTTTTctcttggaaagaaagt
119-137 CE atctgaccccatgggttgcTTTTTctcttggaaagaaagt
188-213 CE atataaattcctgagagtgatttggaTTTTTctcttggaaagaaagt
214-239 CE tctctatttgtgtaagcatggaattcTTTTTctcttggaaagaaagt
412-430 CE tcggcccatgaggaaatgaTTTTTctcttggaaagaaagt
506-526 CE ttgcgttggctttaaggtctgTTTTTctcttggaaagaaagt
41-69 LE gactattctttaaacagtcttaccactgaTTTTTaggcataggacccgtgtct
70-94 LE gttgttcttctgattgtctccaaatTTTTTaggcataggacccgtgtct
164-187 LE tacatatgcacatgttaatgccaaTTTTTaggcataggacccgtgtct
263-286 LE gctcccattgataagtccaactatTTTTTaggcataggacccgtgtct
338-362 LE caatcatgataggtctgtgcaatttTTTTTaggcataggacccgtgtct
363-385 LE gcccataatcacacatccaatacTTTTTaggcataggacccgtgtct
527-548 LE ctttcacacactctgcagggtcTTTTTaggcataggacccgtgtct
549-576 LE acatatatccacattaatgatttcatttTTTTTaggcataggacccgtgtct
577-600 LE ccacgtatgatgtttcctaccagtTTTTTaggcataggacccgtgtct
601-622 LE catgatgggagtttcaccaattTTTTTaggcataggacccgtgtct
138-163 BL cagaaacatcttgatcttagaaaagc
240-262 BL agatgtggggatatcgaattgtc
287-310 BL caacaaaagatttccaatctcaaa
311-337 BL tgttccaaagtaactcacgagtataat
386-411 BL ggtaaggacattaagaaacaccctag
431-456 BL ggtgaaatcgttgtttcatattcata
457-480 BL ctgtttgaggacaagttgcttgta
481-505 BL tgttctgttttccatacacaagaag
Oatp1a6 471-497 CE gaggtagtgatattatgaaacaccctaTTTTTctcttggaaagaaagt
498-518 CE cgtatctgcccatgaggaaatTTTTTctcttggaaagaaagt
742-768 CE ccaatgtataaaggagaattttctgatTTTTTctcttggaaagaaagt
973-994 CE ctttgggagtgtttttggaaagTTTTTctcttggaaagaaagt
995-1017 CE tccccattatcctgtaatccttcTTTTTctcttggaaagaaagt
425-449 LE caccaatcatgataggtctatgcagTTTTTaggcataggacccgtgtct
450-470 LE ggcccataactgcacaaccaaTTTTTaggcataggacccgtgtct
546-567 LE aagctgtttgaggacaagttgcTTTTTaggcataggacccgtgtct
568-590 LE gggatctgttttccacacacaaaTTTTTaggcataggacccgtgtct
640-668 LE ctaccagtacatatatccacattaatgatTTTTTaggcataggacccgtgtct
669-692 LE caccaattccacgtataatgtttcTTTTTaggcataggacccgtgtct
693-714 LE cctaaaggcatgatgggagtttTTTTTaggcataggacccgtgtct
769-794 LE caatcatcttcccaacttctaaaattTTTTTaggcataggacccgtgtct
841-865 LE tgtattcacagaccctgtgtctacaTTTTTaggcataggacccgtgtct
866-888 LE gtgggagttatggtcaggtcatcTTTTTaggcataggacccgtgtct
889-908 LE caccgacccagcgtgtatcaTTTTTaggcataggacccgtgtct
930-951 LE aggacattcactcctgcacagaTTTTTaggcataggacccgtgtct
519-545 BL ttgtaggtgaaattgttgtttcatatt
591-614 BL ggtcttgtgttggctttaaggtct
615-639 BL ttaatttctttcacacactctgctg
715-741 BL ttggcaaagtcttctatataggaaata
795-817 BL catcaaatatccaagtattgggc
818-840 BL taaatgtttgcacagaaaggtcc
909-929 BL ccaaaaagccaatccaccaag
952-972 BL aagaaaaaggggatgctggtc
Oatp1b2 497-517 CE atactcccaatgcccatgatgTTTTTctcttggaaagaaagt
538-562 CE gcatacctgtaatatcccatgaagaTTTTTctcttggaaagaaagt
615-640 CE gttccagtgagtgatgtagtttgattTTTTTctcttggaaagaaagt
476-496 LE aagcaaccagttccaatcagcTTTTTaggcataggacccgtgtct
518-537 LE aatgtggcaacgcagtcagaTTTTTaggcataggacccgtgtct
563-589 LE tgtagagaactgatgtcattttctgttTTTTTaggcataggacccgtgtct
590-614 LE gactaaacaggtcaacgtggagttaTTTTTaggcataggacccgtgtct
641-664 LE cctttctccattatctcaggtgagTTTTTaggcataggacccgtgtct
686-711 LE ccatcaagacataaatccaggtgtatTTTTTaggcataggacccgtgtct
712-732 LE ctatcccacgaagcatgttccTTTTTaggcataggacccgtgtct
665-685 BL gagttggaccccttttcacaa
707-725 LE gcgaggagtcctttctccgTTTTTaggcataggacccgtgtct
751-771 LE caggctggtccaaataccaacTTTTTaggcataggacccgtgtct
633-650 BL ccaggagcacctgagccc
651-668 BL cgggggtagcaccgatgc
669-683 BL cccccaggggctgca
795-817 BL cgcatccacatagatcttggtac
Oatp1c1 1989-2013 CE actgctaaggtgtagatacccagagTTTTTctcttggaaagaaagt
2103-2120 CE gcctgcaggagcctctgcTTTTTctcttggaaagaaagt
2371-2395 CE cccatatttgtttgtttccatgattTTTTTctcttggaaagaaagt
2424-2447 CE gaagcccttttgattatgcttttaTTTTTctcttggaaagaaagt
1907-1933 LE gccacctagagataatgtatatgatgtTTTTTaggcataggacccgtgtct
1934-1962 LE cacctcaagagtaatatatatccaggtatTTTTTaggcataggacccgtgtct
2080-2102 LE ttccacatttcttaaatccccatTTTTTaggcataggacccgtgtct
2143-2167 LE cgtggttaatcccaggtatatgtgtTTTTTaggcataggacccgtgtct
2168-2186 LE cagacaccgtgcccaggagTTTTTaggcataggacccgtgtct
2211-2237 LE tcgagacatattttttctttaaaacaaTTTTTaggcataggacccgtgtct
2238-2261 LE ttgtggttattaagctgctgtgttTTTTTaggcataggacccgtgtct
2287-2307 LE gcgcatgtctcctttttgatgTTTTTaggcataggacccgtgtct
2308-2326 LE caatccacgatcccttgcaTTTTTaggcataggacccgtgtct
1963-1988 BL caaaagacttaagttgtggttgaatg
2014-2035 BL tgggattcctgcaagaactctt
2036-2056 BL aacaccaaagtacacaggggc
2057-2079 BL ttgaggcatgaagtgtcaatcaa
2121-2142 BL ctgaaagcgtgggagtcataca
2187-2210 BL aaagtacagccatgcttaggaaga
2262-2286 BL cttgaagacatccctattttttctc
2327-2346 BL cctggccagtacttgggctg
2347-2370 BL tttttttaaagtcgtgtctccttg
2396-2423 BL ttcatttacatgtattggataaaatgac
2448-2469 BL aagcagaaaggaattgcacatt
665-685 BL gagttggaccccttttcacaa
2121-2144 LE ttctctggtcctgatgcttatagcTTTTTaggcataggacccgtgtct
2184-2202 LE tgccactcctggtcagggtTTTTTaggcataggacccgtgtct
2203-2221 LE ttggcaaacgctcagaggaTTTTTaggcataggacccgtgtct
2242-2261 LE ggtggtgcttccgataccgtTTTTTaggcataggacccgtgtct
2262-2281 LE aggaccctcaggcactggacTTTTTaggcataggacccgtgtct
2057-2078 BL tctctgctctgttgcctcaaga
2167-2183 BL ggggctgggaccgtcaa
Oatp2a1 481-502 CE tgctggtctccttctgggtatcTTTTTctcttggaaagaaagt
557-576 CE gatcccaaatggctgaatggTTTTTctcttggaaagaaagt
679-700 CE cgaagatcctcagcatgactgaTTTTTctcttggaaagaaagt
779-798 CE gcctgaggagatgagcaggcTTTTTctcttggaaagaaagt
464-480 LE gggcacggtgctgtggcTTTTTaggcataggacccgtgtct
503-522 LE caccatcaggctccacatgcTTTTTaggcataggacccgtgtct
523-540 LE ggccagcagctgagcgacTTTTTaggcataggacccgtgtct
541-556 LE gcaccgtcccaacgccTTTTTaggcataggacccgtgtct
599-618 LE cagaggcgagttggtaggctTTTTTaggcataggacccgtgtct
661-678 LE gcccagcaggtacccgaaTTTTTaggcataggacccgtgtct
701-721 LE tgtccactctgccgtagtccaTTTTTaggcataggacccgtgtct
722-742 LE ggctcaggttcactgtagccgTTTTTaggcataggacccgtgtct
743-761 LE atccaccgagggtcacctgTTTTTaggcataggacccgtgtct
762-778 LE ccagccaccaggctccgTTTTTaggcataggacccgtgtct
577-598 BL ctgcaaagtcgtccacatagga
619-644 BL gcgatagcaaataagatggagatata
645-660 BL agccggcccaaacacg
Oatp2b1 1991-2013 CE gaagaactggaggcctatgaatcTTTTTctcttggaaagaaagt
2097-2120 CE tgttgtagttccgagctctttacaTTTTTctcttggaaagaaagt
2145-2166 CE cctcctggaatccttaggcttcTTTTTctcttggaaagaaagt
2222-2241 CE gggtgctgatttgcccattgTTTTTctcttggaaagaaagt
1932-1949 LE ctccgcccacaggtcaggTTTTTaggcataggacccgtgtct
1950-1970 LE tcgtagtagcggcagacagctTTTTTaggcataggacccgtgtct
1971-1990 LE ggtttcggagcaggtcatggTTTTTaggcataggacccgtgtct
2014-2034 LE caccagggatccacttttgaaTTTTTaggcataggacccgtgtct
2035-2056 LE tggccaaaactaaggtaaagcaTTTTTaggcataggacccgtgtct
2079-2096 LE gtggtcctggtgctggccTTTTTaggcataggacccgtgtct
2121-2144 LE ttctctggtcctgatgcttatagcTTTTTaggcataggacccgtgtct
2184-2202 LE tgccactcctggtcagggtTTTTTaggcataggacccgtgtct
2203-2221 LE ttggcaaacgctcagaggaTTTTTaggcataggacccgtgtct
2242-2261 LE ggtggtgcttccgataccgtTTTTTaggcataggacccgtgtct
2262-2281 LE aggaccctcaggcactggacTTTTTaggcataggacccgtgtct
2057-2078 BL tctctgctctgttgcctcaaga
2167-2183 BL ggggctgggaccgtcaa
Oatp3a1 511-529 CE ggtgccttctgcctcccatTTTTTctcttggaaagaaagt
571-589 CE gcagattaggtccgggtcgTTTTTctcttggaaagaaagt
726-750 CE atcgtgaacaggattcctatgtagaTTTTTctcttggaaagaaagt
772-794 CE agaaagagcccagaataaatccaTTTTTctcttggaaagaaagt
491-510 LE cggatctcgacagcctcgtaTTTTTaggcataggacccgtgtct
530-550 LE cccattggtggcacagacatcTTTTTaggcataggacccgtgtct
551-570 LE ggcctgtcatcactgctggaTTTTTaggcataggacccgtgtct
590-607 LE cgtggctgtccggttacgTTTTTaggcataggacccgtgtct
608-632 LE caataagcagcatgtacatcatgttTTTTTaggcataggacccgtgtct
684-706 LE cacgtggtcgtcaatataggagaTTTTTaggcataggacccgtgtct
707-725 LE gcgaggagtcctttctccgTTTTTaggcataggacccgtgtct
751-771 LE caggctggtccaaataccaacTTTTTaggcataggacccgtgtct
633-650 BL ccaggagcacctgagccc
651-668 BL cgggggtagcaccgatgc
669-683 BL cccccaggggctgca
795-817 BL cgcatccacatagatcttggtac
Oatp4a1 1750-1770 CE gctgcctttaggtccagctgtTTTTTctcttggaaagaaagt
1792-1811 CE ggctgtagtgcttcggctggTTTTTctcttggaaagaaagt
1894-1914 CE cagcctcggtataccttctggTTTTTctcttggaaagaaagt
1939-1956 CE gcattgccccagccagagTTTTTctcttggaaagaaagt
1691-1709 LE ctgccatgtgcacattgggTTTTTaggcataggacccgtgtct
1710-1729 LE aacgtagccggtggtcacacTTTTTaggcataggacccgtgtct
1730-1749 LE cctttaggcaggaggctcccTTTTTaggcataggacccgtgtct
1771-1791 LE caacagtagatggcgttgcaaTTTTTaggcataggacccgtgtct
1812-1831 LE gccatctgagccacacagggTTTTTaggcataggacccgtgtct
1832-1856 LE cgtagcagggagagtagtacatggtTTTTTaggcataggacccgtgtct
1857-1874 LE catcagcagggcagcctgTTTTTaggcataggacccgtgtct
1875-1893 LE ccacccaggtctgtctcggTTTTTaggcataggacccgtgtct
1915-1938 LE gaagccttctcaaggatacagctaTTTTTaggcataggacccgtgtct
1957-1974 LE gcgcacttccctgcggtaTTTTTaggcataggacccgtgtct
Oatp4c1 2110-2135 CE ttctgactttgaaatgatacctctgtTTTTTctcttggaaagaaagt
2162-2186 CE ttttctgctttgtctagatcctcttTTTTTctcttggaaagaaagt
2292-2310 CE tccgttctggagcatgggtTTTTTctcttggaaagaaagt
2412-2434 CE gcttttggtgaactttagaggcaTTTTTctcttggaaagaaagt
2136-2161 LE cgaccgaaatagtagacacaatgacaTTTTTaggcataggacccgtgtct
2187-2207 LE cctcctccttttcacccttcaTTTTTaggcataggacccgtgtct
2208-2227 LE gccagttcccaaagcaatctTTTTTaggcataggacccgtgtct
2228-2248 LE aggatgttctcacaggcaggaTTTTTaggcataggacccgtgtct
2269-2291 LE ttcacaccgtggtctacacaactTTTTTaggcataggacccgtgtct
2311-2334 LE atctgtacctaggcaatgatcaccTTTTTaggcataggacccgtgtct
2361-2386 LE gggttttttgtttttgtttattttgtTTTTTaggcataggacccgtgtct
2387-2411 LE tgaacctttatgttttgagtttgtgTTTTTaggcataggacccgtgtct
2462-2484 LE gtgttttcataggttgacaacggTTTTTaggcataggacccgtgtct
2094-2109 BL tcctgggggcggtggt
2249-2268 BL agacaatggtgccttggcac
2335-2360 BL tgttgtttgttttaagaaaatgagga
2435-2461 BL aaataaataaaatgtgagtggtttgag
Oatp5a1 329-349 CE agtgctcagtgggaattccctTTTTTctcttggaaagaaagt
370-389 CE acttctcagctttgctgggcTTTTTctcttggaaagaaagt
453-472 CE gcatgggaatcccttttgcaTTTTTctcttggaaagaaagt
494-517 CE ggaacttactgcttctgagaaaggTTTTTctcttggaaagaaagt
310-328 LE gcacctccgcctctgcaatTTTTTaggcataggacccgtgtct
350-369 LE tggcccacttgctcactcacTTTTTaggcataggacccgtgtct
390-410 LE ggcatgatgtagtccgggagtTTTTTaggcataggacccgtgtct
473-493 LE tcccggatatgtctgtgtggtTTTTTaggcataggacccgtgtct
518-536 LE cctgcccagggtctgcagaTTTTTaggcataggacccgtgtct
555-577 LE gcttcagcagggatgttacaaagTTTTTaggcataggacccgtgtct
598-622 LE cgtattcaactcaaccaacaaaatcTTTTTaggcataggacccgtgtct
578-597 BL catctgtctgccttctccgg
411-429 BL ccctgggtgctgaaggctg
430-452 BL gagcagtttcttcatggacttcc
537-554 BL cagcatcggggctctcgt
Oatp6b1 1004-1023 CE tctgcatttgccaatccatgTTTTTctcttggaaagaaagt
1171-1195 CE gcccagtgaatgtaaattatgaggtTTTTTctcttggaaagaaagt
1223-1243 CE cccagggatggatccaaataaTTTTTctcttggaaagaaagt
1444-1466 CE tgcttcttttctttgcattcttgTTTTTctcttggaaagaaagt
1024-1046 LE catcaatgggatcagcttcagaaTTTTTaggcataggacccgtgtct
1071-1093 LE aaacaaaggcaatgcataacactTTTTTaggcataggacccgtgtct
1148-1170 LE acagttcggaggataatcaaggtTTTTTaggcataggacccgtgtct
1267-1291 LE gtcccagtaaatacaagaacgacttTTTTTaggcataggacccgtgtct
1292-1317 LE cgtcctttgtctccacatttatttatTTTTTaggcataggacccgtgtct
1318-1346 LE tcatttttaacttattatagatccaacaaTTTTTaggcataggacccgtgtct
1347-1372 LE aatacagaatcccatcagtatgaacaTTTTTaggcataggacccgtgtct
1373-1392 LE gttgtggccaatttgcaaaaTTTTTaggcataggacccgtgtct
977-1003 BL tttaatgcaagaacaattgtagaatgt
1047-1070 BL tggtgttacattttccagaagtgg
1094-1118 BL caattgaagaaaagaaaaaagcaaa
1119-1147 BL gattggtatactagctgaactagaaaaag
1196-1222 BL tctcaaagttgtataggtcacagctat
1244-1266 BL gctgttaattgaaaaagcagtgg
1393-1417 BL aaaaaatgccaagagagtaaagaag
1418-1443 BL cttccaactctggaaacattatattt
1467-1492 BL ttttgcctcttttattttttattttt
Oatp6c1 757-777 CE tccctgctatgccatggatacTTTTTctcttggaaagaaagt
846-871 CE agatatgcagaatgtccaatagctaaTTTTTctcttggaaagaaagt
919-941 CE gactgttttttctttgggtggagTTTTTctcttggaaagaaagt
1086-1106 CE gggaggttcctttcttttcgcTTTTTctcttggaaagaaagt
690-712 LE actatgctttgtcttcccggtatTTTTTaggcataggacccgtgtct
713-738 LE aatagatacattttgatctgttcggaTTTTTaggcataggacccgtgtct
739-756 LE actgcccagcgatgtggaTTTTTaggcataggacccgtgtct
778-799 LE atgccaaggatataaattggcaTTTTTaggcataggacccgtgtct
942-962 LE caccttcgctggttcaatttcTTTTTaggcataggacccgtgtct
1134-1156 LE cccttcaaatgaggttgaattttTTTTTaggcataggacccgtgtct
800-823 BL ggaatgtggtcaaaaatgaaggtt
824-845 BL atagaagccgcatgaacttgtg
872-896 BL taccatacccagaaggtatcctatc
897-918 BL gctgaaaattctgcagtcctcc
963-984 BL acccactctgcaacagttggta
985-1009 BL gcaataatcaaaaaagttttccacc
1010-1034 BL gaaagatacacaaaatgagattgca
1035-1060 BL aaactagttggaaaacataccatcat
1061-1085 BL aagtcttaacttatgtgcaccaggt
1107-1133 BL catatctttaagtctcctgtcaatggt
Oatp6d1 154-176 CE tttcctgggttccttagttttctTTTTTctcttggaaagaaagt
226-253 CE cgatctgactttttcatatctggtgtatTTTTTctcttggaaagaaagt
545-565 CE cctgttagaaagcagccagctTTTTTctcttggaaagaaagt
130-153 LE ggtgttcatccatgtctaccacctTTTTTaggcataggacccgtgtct
203-225 LE ctgcaaacttcttcactgcagttTTTTTaggcataggacccgtgtct
254-276 LE cctccgagggatctttgtattttTTTTTaggcataggacccgtgtct
277-297 LE gagagcccaaaccatatggctTTTTTaggcataggacccgtgtct
345-366 LE cgaccgctaaaaacgacagagtTTTTTaggcataggacccgtgtct
367-392 LE aagagcaaatatcatactatgagccaTTTTTaggcataggacccgtgtct
446-475 LE aaattatcactagtatccattaagtattccTTTTTaggcataggacccgtgtct
524-544 LE gccacccaatttgctctatttTTTTTaggcataggacccgtgtct
566-587 LE agcaaaaacaattgcagcaattTTTTTaggcataggacccgtgtct
177-202 BL ggaagtgttaccaggaacatttctaa
298-319 BL cgctgtaaacaagggaaaacga
320-344 BL caggaaggacttaacattgttgaaa
393-420 BL ccacgtaaagttttatagactgatcaac
421-445 BL tctatccgtgatggagatagttgag
476-499 BL aacattgagaacagaaaagcaaca

500-523
BL
cctctacctccaaagtgtgctaca
  • CE, capture extenders; LE, label extenders; BL, blockers.