TABLE 1

Taqman primer and probe sequences of mouse P450 mRNA


Gene

Primers/Probes

5′ → 3′ Sequence

Amplicon Size
bp
CYP3A11 Forward TCACACACACAGTTGTAGGGAGAA 64
Reverse GTCCATCCCTGCTTGTTTGTC
Probe ACAGAGAAGTAAATTGC
CYP3A13 Forward ACCGGCGGCGCTTT 59
Reverse ATTCTCAGAGATAGAGATGGCCTTTT
Probe TCCAGTGGGTATTTTG
CYP3A25 Forward CTTCACTGTCCAGCCTTGTGAA 61
Reverse AATTGGTTCCCTGCTGATCTTC
Probe AGACACAGATCCCCC
CYP3A41 Forward GGTTGTACCACGGGATGTAGTTATAA 95
Reverse TCTGATGTTCTTAGACACTGCCTTTC
Probe TCAAGGAGTTCTGCTGAGTT
β-Actin Forward TTCTTTGCAGCTCCTTCGTT 75

Reverse
GACCAGCGCAGCGATATC