TABLE 1

PCR amplicon information for ABCB4


Fragment Name

Primer Designation

5′-3′ Primer Sequence

Product Size
bp
PromA7 ME_PA7f CAAGTTCCGACAACTGGGATG
ME_PA7r TGCAATACTCAGAGGACCACTAAAAA 498
PromA6 ME_PA6f2 GACAATCAGTAGATCCTTCTATTCAGC
ME_PA6r1 AGTTCCAAGGTCACATTGCCTAATG 637
PromA5 ME_PA5f ATCCATTTCATCGTTGCCTTG
ME_PA5r CCCTTCTCATTGCTTGACTCAGA 441
PromA4 ME_PA4f TGCTGGGCCGAATTAGATGAA
ME_PA4r CAGAGAATAACAAATTCCATCTACCAA 541
PromA3 ME_PA3f TCCATCATAGCACCCTCTTTAGGAA
ME_PA3r AAGGACCTGGGCTAAGGTTTTAGGA 554
PromA2 ME_PA2f CCTTGAACATGCTCCTTGTTTTGA
ME_PA2r AGCACTCCACCTCAGGGTGTTT 510
PromA1 ME_PA1f GGAACTGAGAGTCCTGAGGGTACAA
ME_PA1r GAATCTGACCTTTGCCCTGCAC 499
PromB8 ME_PB8f GGCAATGTAAAAGTTAGGGGTGAA
ME_PB8r TGCAGTATCACTGAGAATTCCATC 456
PromB7 + Exon -3 ME_PB7f ACAGCCTGAGTGTAATGGAGAAA
ME_PB7r CAAATTCCTTCCCTTCACTGGT 506
PromB6 + Exon -3 ME_PB6f CCAGTCACCACAAGCCTTCTTT
ME_PB6r TTTCCCATGTACCAGCTGTCTG 501
PromB5 + Exon -2 ME_PB5f GGCCTCGCCTGAACTTTTACTA
ME_PB5r TGTGCTCATTTCTCTAGGCCTGT 502
PromB4 ME_PB4f TCGCAATAACCTGATAAGGGAGA
ME_PB4r CTGTTGGTGCCCTCTTAGCACT 482
PromB3 + Exon -1 ME_PB3f AGCCTCAGGCAGGACTTCAC
ME_PB3r AAGCCCCTGCAGATGACTGT 389
PromB2 ME_PB2f ATTGCTCTCTCTCGGTCCTG
ME_PB2r CAGAGGGGCCTGGACTTTG 440
PromB1 + Exon 1 ME_1f GGCTGCAACGGTAGGCGTTT
ME_1r GGCGTGTAACGGAAAAGCCAGT 434
Exon 2 ME_2f GCGAGGTTCGAGGTGAGAGA
ME_2r AACCGGATGCAAGACCCTTC 404
Exon 3 ME_3f1 CTCTGTAAGGCAGGCGACCA
ME_3r1 CTCAAGCAACCCTCCCACCT 453
Exon 4 ME_4f GAAGGCCTCCTTTTCTAAGACATTCA
ME_4r TGGAGTCAACCAGATATCCAAATC 416
Exon 5 ME_5f CAGTACCTAAACCCTTGGGCTCT
ME_5r GGGCCATGATGTGTGCATCT 432
Exon 6 ME_6f TGAGATGGTGCCACTGCACTC
ME_6r ACATGGCTGCCAGATGATCG 450
Exon 7 ME_7f CTGAAAGAGGCTTGCAGTCAGTG
ME_7r CACCCAGCCTGTGACATTTTGAA 488
Exon 8 ME_8f CCAGAACACTGGCATTTGCTAC
ME_8r TAGCCATCAGTAAAGGGTGCTTA 415
Exon 9 ME_9f CGAGTGTGACTCGGACTATGG
ME_9r GAAAGTCAGCTCTGCCCACT 402
Exon 10 ME_10f CCTTGCAAATGTTGCTCTTCCAC
ME_10r GCTCAAAGACTTCTTTTGGCACTA 309
Exon 11 ME_11f CCAGGTCCTATTTTTGGAATTTGCTGA
ME_11r AACCCCCAAAGGAAAAGGCACATAA 322
Exon 12 ME_12f GTGCCTTTTCCTTTGGGGGTTA
ME_12r TGAAACCAGCCCAAGGGTGT 423
Exon 13 ME_13f GGATGTTTTTCATGAATGGTCCTG
ME_13r GCAAAGTTGGACAATCTTGCATC 403
Exon 14 ME_14f CCAACTTTGCTAGATAAGTCCCCT
ME_14r CGGAAGCACTGGCAAGAATC 500
Exon 15 ME_15f ACAAACAGCATTCATCCAAGTGC
ME_15r TGGCACTTTCCCCTATTTTCTCA 450
Exon 16 ME_16f CATCCATTTGGAGACACACACAC
ME_16r GTAGCAGTCATCTGTGCCTGAAA 352
Exon 17 ME_17f TGCACCTAGTTTGCGAGTCC
ME_17r CAGAATGGAGCCAGTCAGTG 350
Exon 18 ME_18f CTGGTGAAGGTTGCACAACAATG
ME_18r CAGCAGAGCCTTATGCCAATCA 468
Exon 19 ME_19f TGAGGATCCGTGGCAACTGTA
ME_19r CAGGACTCTGCCCCATCCTT 339
Exon 20 ME_20f TGGAGCTTTGGGAGGCTTTGT
ME_20r GGGGCAGTGGGTCAATCAAC 344
Exon 21 ME_21f CCAAGAGGCTAAGGCTGGAG
ME_21r AGGCTCAACGTTTTATGTTAATCAC 484
Exon 22 ME_22f1 GCACAGCCAGAAGTACCAGTTTTGTC
ME_22r2 TGGAGCAGCAGAGCTTTTATTATCT 382
Exon 23 ME_23f CCACTCGGCCAGACTTAGAAG
ME_23r CCTGCCAGGATGGAAACTGTG 380
Exon 24 ME_24f TCGGGGAGAAAGGGGATGATT
ME_24r GCAGACAGCAAACCTTAGGGAAA 347
Exon 25 ME_25f TGGCACCAGAACTATACCAAATATGA
ME_25r GATATGGTGCCAGTTGGGGTTT 486
Exon 26 ME_26f CCTCATGCAACGATCCTCCA
ME_26r GGTATCCTGAAGTGCCTTGTCCA 448
Exon 27 ME_27f AAACACTCTGTTAAGTTGAAACAACG
ME_27r3 GTTCTGTGTTTTTCCCCCTGTGCTT 383
Exon 28 ME_28f1 CATGGGAACCCATTTGTGTTATATT

ME_28r2
GGGAGAGCTAGCCTGTTGTTTCAA
641