TABLE 2

PCR amplicon information for ABCB11


Fragment

Primer Designation

5′-3′ Sequence

Product Size
bp
Prom9 BS85 CCCCACTCCCAGAGTTTCTGATT
BS86 ACATCAGATGGTGTAAATGGTATGGAGA 500
Prom8 BS03 TGGCAACATCCTTCTCCCCTC
BS04 CATGCTGGCCAGACACATCTG 444
Prom7 BS05 GGGACCACAACCCTACCTATTTTCA
BS06 ACAGCAGTCAAAGGGTAAAAATGCC 388
Prom6 BS07 AAAACTCTATGCTTTTATCTTCCCTTGGAT
BS08 GTTCAAATCTCAAATATATCAAGGTCAGCAA 390
Prom5 BS09 TTGGTGCCAAATCCAATATTACTACATTT
BS10 ACATGCCAGTCTGTGCTAACCTTCT 374
Prom4 BS11 CAAATTAAGAAGCACTGGCCCATC
BS12 TGAGCTTACTTTTCCCTAAATGCCTCT 325
Prom3 BS91 TAGGGCTGTTGAGAGGCCCAAAT
BS92 CAGATGCTCCTGGCCCAGCTA 439
Prom2 BS15 ATACAGAGCTTCATCTGGTGTGTCCA
BS16 CATACGAGAAACATACTCAGAGCAATAACC 432
Prom1 + Exon 1 BS81 AAAATAAGGGTTGGGATAGCCTGAAT
BS82 GTAGCGTTGTTTACACTGGACAAGAGAC 487
Exon 2 BS19 TGTCTGAGATTGATTAGTAAAGATTATTTCTTGAAC
BS20 TGCTGATTTTTTTCTGCTCCTTGAA 322
Exon 3 BS77 GCAGGAAGAAAGAAAAGGCAAATAGTC
BS78 GCAATGTGCATGAAAGTATTCTCTGCT 275
Exon 4 BS23 CTAAAGAATAACTCATAAAATCACCACCTAGGG
BS24 CACTGAAGTTAAAAACCTGCCAATATGACTA 252
Exon 5 BS25 ATTCCCATGAAATTTGGTGTTGAGTACTA
BS26 AGCTCAGCCAGTAAAATCCCCTCTATA 449
Exon 6 BS89 CTGGTGGCTTGATCCTACTTGCA
BS90 CTCCATTCTCTCATGTCCTCTGGAA 283
Exon 7 BS29 TCTGAATTACTTTCCCCCTTTTCTCAA
BS30 GATGAAACATAGGAAAACTGAAAATATTTTTAAAT 361
Exon 8 BS31 AGGGTGATAGGGATAGAGAGATGGGA
BS32 GCTAACTGTACTCAGGAAAAGGGACTCA 384
Exon 9 BS33 TGAGAATCTAATATTGTATTAAACCCATGCC
BS34 CAAGGTGGGTCTGCCGCTT 333
Exon 10 BS35 GCTGCTCTGTGTTTGCGATGATT
BS36 TCCTGAAGGCACCAAAGTAATAAACAA 396
Exon 11 BS95 GATAACTCTCTGCGTTAACATGGAAGACC
BS96 AACTTTAAGGTAAATTCTTCAGGAGTTCATTCTG 301
Exon 12 BS39 CTAAGAGGCACAATAAATGTATACATCTTCATTT
BS40 GAAACAGAGTCAGGCTTCAGAAAATGA 387
Exon 13 BS41 CACACAGACACCGAGTATCAACACAA
BS42 CAGGACAGTCTCAATGTATGCTACACCT 333
Exon 14 BS43 AGAATCTTATTGGCCTCTATTTTTTCTGC
BS44 TTGGGAATCATACGAGAAGAAATGTGTA 411
Exon 15 BS45 CGGAGCAGTGAAAATTCGTGC
BS46 TCAACTACTCCCATCCCTCCCAC 392
Exon 16 BS47 TATTCCCAGGGACCAAGGATCTAACTT
BS48 GTTGTTGGGAGAACAGTGAGTATTGAAA 416
Exon 17 BS49 CATAGTAAAGAATTCTACTTGGATATGGTTCTGTT
BS50 CTCAGAGTTTCCTTGTTGTACCTGAGATATT 247
Exon 18 BS51 TACCATGTGACCTACCAAACATTTCTATTTATT
BS52 CCTAGAAAACTCATATTCTCAGGCTTAAAGG 318
Exon 19 BS99 AACTAATCAAACTATGACTCTTAAATCTGTGAATGC
BS100 GAGAAAAATGAACTAACAGAAAAGAGCTAAATACATG 382
Exon 20 BS103 CTTACATTAGGGTTCACTCTTGGTGTTGTA
BS106 TTTGTTAGGAGCTCCCCAGATTTAGCAA 383
Exon 21 BS57 TGTATCTCTTTTCACCCAATTTCTACAGGT
BS58 GGTCCCTATTCCATAGAAAACATGCA 381
Exon 22 BS59 CATTCTGCCATTTGCACCATCTAAT
BS60 GCTTGGGATGGTTTGCTAAGCA 443
Exon 23 BS61 ATATTTTATCACAACTTTATAAAAGGTCTGACCTTTT
BS62 GCTTCCTTCAGTCTCTTCGTACTACTCG 401
Exon 24 BS63 ATATTTGGTCCTTTCCTGGCAGAAC
BS64 CCCACACCATCCCCTGACA 488
Exon 25 BS65 TTTGGCAGCATGGTTTGAAGG
BS66 GAGTCTGGCAAAGCAAAAACTTGAAG 407
Exon 26 BS67 GGGATTGTTAGTCTGTTAAGCAAACCAA
BS68 GCTCAACCTGTACACTCTGGTCATTCTAC 406
Exon 27 BS107 ATTACAGAGGAGACCTTGACATGAGTTCAG
BS108 CGAATCAGAAAATTGAAAATAGTGCCATT 334
Exon 28 BS75 CAAGTATAGGATTGTTATTCAGGTCGTGTTAA

BS76
TTGGGTTTTCCCTCACATGGAC
556