Amplification and DHPLC conditions for CYP2W1 SNP analysis of genomic DNA
Exon | Size | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Annealing Temperature | PCR Cycles | DHPLC Temperature |
|---|---|---|---|---|---|---|
| bp | °C | °C | ||||
| 1 | 264 | ggacggggcccaggaggggagtgga | ggcagctgtccaagcggcaagagct | Slowdowna 70.0-55.0 | 63 | 64.8, 67.5 |
| 2 | 253 | cttgtgggtgagggctgcccgggtg | tgcccccacacccagtaggccccgt | 60.0 | 35 | 66.5 |
| 3 | 240 | ctggggtgggaacctgggctcacca | ggcacgtccaggcccggggaggggc | 60.0 | 35 | 65.0, 67.5 |
| 4 | 248 | cccctccccgggcctggacgtgcct | actccaggctccaccccaccccaag | 60.0 | 35 | 64.0 |
| 5 | 264 | cctggggctgcgtccttatctccgc | caggacccctacaggccttcaagga | 60.0 | 35 | 65.5 |
| 6 | 229 | acagaccccagatcatcccacgagc | ccccgggggcagaaggagccgtctc | 60.0 | 30 | 66.4 |
| 7 | 275 | acgagggatggcgctgccacccaag | cctaccccagaggagatggaagggg | 60.0 | 35 | 66.8 |
| 8 | 232 | atcttccccggggcccctctctctg | gagccctggaggtgccgccccaccc | 60.0 | 35 | 65.4 |
| 9 | 278 | agcaggcctggtgcagcccactctg | gctgggaggggagtggtcaggagga | 60.0 | 35 | 66.8 |
↵a Slowdown protocol: The annealing temperature was decreased after cycle 3 by 1.0°C every three cycles beginning at 70°C and decreased to a “slowdown” annealing temperature of 55°C followed by 15 additional cycles with an annealing temperature of 60°C. The PCR was used with a ramp rate at 2.5°C/s and reaching annealing temperature at 1.5°C/s.