TABLE 1

Human MAT2A and MAT2B genetic polymorphisms

Polymorphisms in MAT2A and MAT2B exons and untranslated regions (UTRs) are numbered relative to the A (nucleotide 1) in the ATG translation initiation codon. In the case of MAT2B, we used the ATG in exon 1a. Negative numbers are assigned to positions 5′ to that location, and positive numbers are assigned to for positions 3′ to that location. Nucleotides located within introns are numbered based on their distance from the nearest splice junction, with distances from 3′-splice junctions assigned positive numbers and distances from 5′ splice junctions assigned negative numbers. Polymorphisms within exons are boxed. Amino acid changes in MAT2B are numbered for the 334 amino acid protein of MAT2B V2. Previously identified polymorphisms are indicated by rs number.

MAT GenePolymorphism LocationNucleotide Sequence ChangeAmino Acid Sequence ChangeMinor Allele Frequencyrs Number
AAEAHCA
2A5′FR (−2453)del TTTTG0.0000.0050.000
2A5′FR (−2442)T > C0.0000.0000.005
2A5′FR (−2405)T > C0.2290.5470.641rs3755014
2A5′FR (−2384)G > C0.0160.0470.000rs72844458
2A5′FR (−2370)A > G0.2290.5470.641rs3755015
2A5′FR (−2338)T > C0.0000.0050.000
2A5′FR (−2237)A > C0.0100.0050.000
2A5′FR (−2205)C > T0.0100.0000.000
2A5′FR (−1976)T > C0.0000.0160.000rs13020028
2A5′FR (−1905)A > T0.0940.0050.000rs72940556
2A5′FR (−1883)G > T0.0000.0000.005
2A5′FR (−1829)G > A0.0100.0050.000
2A5′FR (−1749)ins A0.0000.0050.000
2A5′FR (−1716)G > A0.0100.0050.000
2A5′FR (−1606)del CT0.0050.0000.000
2A5′FR (−1483)T > C0.0000.0000.005
2A5′FR (−1451)T > G0.2190.5470.641rs1446668
2A5′FR (−1445)A > T0.4060.2290.307rs1048740
2A5′FR (−1443)T > G0.4060.2290.307rs1048739
2A5′FR (−1418)G > A0.0000.0050.000
2A5′FR (−1344)C > T0.0160.0000.000
2A5′FR (−1218)G > A0.0050.0000.000
2A5′FR (−1206)C > A0.0630.1980.005rs6729475
2A5′FR (−1169)G > T0.0260.0000.000
2A5′FR (−1157)T > C0.0000.0000.005
2A5′FR (−1040)ins C0.0050.0000.000
2A5′FR (−973)C > G0.0100.0000.000
2A5′FR (−972)C > T0.0630.1980.005rs4258795
2A5′FR (−970 to −969)ins C0.4060.2290.307
2A5′FR (−970)T > G0.0520.0160.135rs1446667
2A5′FR (−940)G > A0.0940.0100.005rs72940558
2A5′FR (−698)G > A0.0000.0050.000
2A5′FR (−678)C > G0.0000.0000.010rs17026411
2A5′FR (−556)C > T0.0100.0000.000rs60048404
2A5′FR (−474)G > T0.0360.0000.000rs60749033
2A5′FR (−458)C > T0.0000.0050.000
2A5′FR (−454)G > A0.0000.0000.010rs17026416
2A5′FR (−440)G > A0.0100.0000.000
2A5′FR (−399)A > T0.0050.0000.000
2A5′FR (−372)T > G0.0050.0000.000
2A5′FR (−140)G > T0.0000.0050.000
2A5′FR (−132)G > A0.0360.0000.000rs6733827
2A5′FR (−129)C > G0.0160.0420.000rs2028106
2A5′UTR (−120)G > A0.0000.0050.000
2A5′UTR (−111)G > A0.0000.0050.000
2A5′UTR (−97)C > G0.0000.0050.000
2A5′UTR (−92)A > G0.0000.0000.010rs17026419
2A5′UTR (−16)G > A0.0000.0000.005
2AExon 1 (32)C > TAla/Val (11)0.0050.0000.000
2AIntron 1 (44)C > T0.4060.2340.307rs2289972
2AIntron 1 (60)C > T0.0000.0050.000
2AIntron 1 (−46)ins ATAC0.0470.0000.000
2AIntron 2 (47)A > G0.0780.0000.000rs58507836
2AIntron 3 (70)G > A0.0050.0470.000
2AExon 4 (318)G > T0.0050.0000.000rs72940560
2AIntron 4 (11)G > C0.0000.0000.005
2AIntron 4 (32)T > C0.0470.0000.000rs62620249
2AIntron 4 (−19)G > A0.0100.0000.000
2AExon 5 (501)A > G0.0050.0000.000
2AIntron 5 (−32)A > G0.0100.0000.000rs1078005
2AExon 6 (613)A > GIle/Val (205)0.0000.0000.005
2AIntron 6 (−68)T > C0.0050.0000.000
2AExon 7 (792)G > C0.2760.5420.641rs1078004
2AExon 7 (813)T > C0.0050.0000.026
2AIntron 7 (17)del TA0.0000.0050.000
2AIntron 7 (−62)G > A0.0000.0050.000
2AIntron 7 (−49)A > G0.4060.2340.307rs2043675
2AIntron 7 (−19)G > A0.0100.0000.000
2AIntron 7 (−3)ins T0.0100.0000.000
2AIntron 8 (55)G > A0.0000.0050.000
2AIntron 8 (57)ins GA0.0000.0050.000
2A3′UTR (1299)G > A0.0050.0000.000
2A3′UTR (1464)T > C0.0050.0000.000
2A3′UTR (1590)T > C0.0680.0000.000rs6711750
2B5′FR (−1043)A > T0.1040.2810.724rs10462941
2B5′FR (−924)A > G0.0000.0050.000
2B5′FR (−544)T > A0.0000.0000.005
2B5′FR (−467)G > A0.0470.0000.000
2B5′FR (−362)A > C0.1250.0000.000
2B5′UTR 1a (−133)G > A0.0000.0000.005
2B5′UTR 1a (−114)T > G0.0000.0260.000
2B5′UTR 1a (−3)G > A0.0050.0000.000
2BExon 1 1a (28)C > A0.0420.0000.000
2BIntron 1a (8)C > A0.0000.0000.005
2BIntron 1a (981)C > G0.0000.0050.000
2BIntron 1b (990)A > G0.1120.0000.000rs7726100
2BIntron 1b (1288)C > T0.1990.1460.083rs7734424
2BIntron 1b (1337)G > A0.1120.0000.000rs7709905
2BIntron 1b (1598)del AAC0.0910.0000.000
2BIntron 1b (1656)G > A0.1000.0000.000rs7710409
2BIntron 1b (1717)del TT0.0060.0000.000
2BIntron 1b (1751)C > T0.0110.0260.078rs28364754
2BIntron 1b (1760)A > G0.1000.0000.000rs10062614
2BIntron 1b (1767)del GAGATGTGTCCATTATGCTCTA0.1090.0000.000rs34602754
2BIntron 1b (1942)del A0.0000.0000.005
2BIntron 1b (1960)C > G0.0000.0000.016
2BIntron 1b (1978)C > A0.0050.0000.000
2BIntron 1b (2045)G > T0.0160.0000.000
2BIntron 1b (2049)T > G0.1080.0000.000rs57122772
2BIntron 1b (2157)T > C0.0110.0000.000
2BIntron 1b (2376)del G0.0430.0000.000
2BIntron 1b (2392)T > G0.1830.1460.083rs299299
2BIntron 1b (−49)G > T0.0100.0000.000
2BIntron 2 (57)A > T0.0160.0310.078
2BIntron 3 (64)A > G0.0360.0000.000rs964945
2BIntron 3 (70)G > A0.0520.0000.000rs7729611
2BExon 4 (492)A > G0.0830.1350.005rs17061795
2BIntron 4 (78)T > C0.0000.0050.000
2BIntron 5 (6)del AAG0.0160.0000.000
2BIntron 5 (51)C > T0.0000.0100.000
2BIntron 5 (−104)C > T0.0160.0000.000
2BExon 6 (781)C > TPro/Ser (261)0.0000.0000.005
2BIntron 6 (29)A > G0.2140.6350.807rs7733775
2BIntron 6 (−205)C > T0.0160.0000.000
2BIntron 6 (−202)G > T0.0050.0000.000
2BIntron 6 (−153)C > A0.0160.0000.000
2BExon 7 (820)C > T0.0000.0000.005
2BExon 7 (872)C > TThr/Ile (291)0.0000.0000.031
  • rs, reference SNP IDs.