TABLE 4

Real-time PCR primer sequences (5′-3′)

Protein-Coding Gene NameForward PrimerReverse Primer
GAPDHtctcctctgacttcaacagcgacccctgttgctgtagccaaattc
ASBTgttactccctggggtttcttctgggagcgggaaggtgaatacgaca
MRP3GCCACAGTCCTTCTTTGACAattgagcagcatgaggatga
OSTαcagattgcttgttcgcctccattcgtgtcagcacagtcattag
OSTβcaggagctgctggaagagatgaccatgcttataatgaccacca
I-BABPgcaaggaaagcaacatacagacaatgatctctgaggtctggtgatagttg
BCRPcaggtctgttggtcaatctcacatccatatcgtggaatgctgaag
MDR1ctgtattgtttgccaccacgaagggtgtcaaatttatgaggcagt
FXRaggggtgtaaaggtttcttcaggaacactttcttcgcatgtacatatccat
SHPgcttcaatgctgtctggagtccttggaggcctggcacatc
PXRtccccaaatctgccgtgtatagcccttgcatccttcacat
VDRTGCcgcatcaccaaggacaactgctcctcagacagcttggg
iNOSggctgccaagctgaaattgcgtgatagcgcttctggctc
TNFαtcttctcgaaccccgagtgacctctgatggcaccaccag
CYP3A4gatgaagaatggaagagattacgatcctcagatttctcaccaacaca
SULT2A1ccacctccccatccagttattaacatctctgggatttctcatgagat
  • GAPDH, glyceraldehyde 3-phosphate dehydrogenase; I-BABP, ileal bile acid binding protein; TNFα, tumor necrosis factor α.