TABLE 2

Primer sequences for quantitative real-time polymerase chain reaction

GenePrimer Sequences
Nrf2Forward: 5′ – TCTATGTCTTGCCTCCAAAGG – 3′
Reverse: 5′ – CTCAGCATGATGGACTTGGA – 3′
Keap1Forward: 5′ – GGCAGTGTGACAGGTTGAAG – 3′
Reverse: 5′ – GATCGGCTGCACTGAACTG – 3′
Nqo1Forward: 5′ – TTTAGGGTCGTCTTGGCAAC – 3′
Reverse: 5′ – GTCTTCTCTGAATGGGCCAG – 3′
Ho-1Forward: 5′ – GAGCCTGAATCGAGCAGAAC – 3′
Reverse: 5′ – CCTTCAAGGCCTCAGACAAA – 3′
GclcForward: 5′ – CTGCACATCTACCACGCAGT – 3′
Reverse: 5′ – TTCATGATCGAAGGACACCA – 3′
GclmForward: 5′ – CGGGAACCTGCTCAACTG – 3′
Reverse: 5′ – TTGGGAACTCCATTCATTCA – 3′
Mrp3Forward: 5′ – AGTGGCTGTGATAGTCTTGCTGATA – 3′
Reverse: 5′ – CCGTTCAGGATCTCGCTCAT – 3′
Mrp4Forward: 5′ – ACCTCTGCTCGCGCGTGTTCT – 3′
Reverse: 5′ – CCAGTACCGTTGAAGCTCCTCTCC – 3′