TABLE 1

Oligonucleotides for the dUGT1As cloning

Inserted restriction site sequences are underlined.

No.NameDNA sequence (5′->3′)
1d1A-Eco-Fttgaattcgaagcctatgttaatgcttctg
2d1A-Sal-Rtttgtcgacgtgtgccttggatttgtgag
3d1A1-Bam-Faaggatccgtagcaaagacaagggcacca
4d1A1-Eco-Rtcgaattccccggggatcttggatag
5d1A2-Eco-R2ttcgaattccttggatagtgggtttttgctg
6d1A2/3/4-Bam-Faaggatccggtgctttgggcttctacag
7d1A2/3/4-Eco-Rtcgaattcctgagacaatggcttc
8d1A2/3/4-Nde-Fagaccatatgacgttcctgcaaagggtca
9d1A2/3/4-Nde-Racgtcatatggtctgaattccttgttaatctg
10d1A6-Bam-Fgcggatccctgtcctctcccccagatg
11d1A6-Eco-Rtcgaattcctgaggcaggactcccttca
12d1A7/11-Bgl-Fcaaagatctggattgccctggactgcag
13d1A8/9/10-Bgl-Fcaaagatctggattgccctgggctgcag
14d1A7-Eco-R2ccgaattcctttggcaatgtctttcc
15d1A8/9/10/11-Eco-Rccgaattcctttggcaatggctttcc