TABLE 1

Primer sequences used for real-time RT-PCR

GeneForward (5′-3′)Reverse (5′-3′)
ALBTGATTGCCTTTGCTCAGTATCTTAGCAGTCAGCCATTTCACCAT
CARTGCAACTGAGTAAGGAGCAAGAAAAGGGCTGGTGATGGATGAA
CYP1A1GTCTTTCTCTTCCTGGCTATCTACCTGTTGTCTCTGGAGGGT
CYP2B6GGTTCAGCGCCACCCTAACACTTTCCCATCCCGAAGTCCC
CYP2CCTCCCTCCTGGCCCCAGGGAGCACAGCTCAGGATGAA
CYP2D6GACATCCCGTGACATCGAAGTACCAGCAGGGAGGTGAAGAAGAGG
CYP2E1CAACGTCATAGCCGACATCCTCTTCTCCATTTCCACGAGCAG
CYP3A4GATGAAAGAAAGTCGCCTCGAGGTGGTGCCTTATTGGGTAAA
CYP4A11TTGCCCAAAGGTATCATGGTCTTTCCCGATGCAGTTCCTTGA
EGR1CAGTGCCATCCAACGACAGGGGACTGGTAGCTGGTATTGAG
HNF1αCCCAGCATCCCAGCAGATCCCGGTTGGCAAACCAGTTGTA
HNF4αACCCAGCCTACACCACCCTTGGCTTTGTCCACCACGCACT
PXRCAACGCAGATGAGGAAGTCGCTTGAAATGGGAGAAGGTAGTGT
18S rRNACGGCTACCACATCCAAGGAAGCTGGAATTACCGCGGCT