TABLE 1

Primers for quantitative real-time polymerase chain reaction

GeneForward Primer (5′→3′)Reverse Primer (5′→3′)
GAPDHAACAGGGTGGTGGACCTCATGGAGGGGAGATTCAGTGTGG
PORTTTCGCTCATCGTGGGTCTTCCTCCCCGTTTTCTTCATCT
PXRACAGCTGGCTAGCATTCCTCACTTGCCTCTCTGATGGTCCTG
HNF4αAGCGATCCAGGGAAGATCAAGAGCAGCAGCAGCTCTCCAA