TABLE 2 

Primer sequences

GeneForward PrimerReverse Primer
ALAS1GATGTCAGCCACCTCAGAGAACCATCCACGAAGGTGATTGCTCC
CARTGCTGCCTCTGGTCACACACCCCGCAGAGGAAGTTTTGTG
CPEB3GGTGTTTGTTGGAGGACTTCCTCCCTCTTGGAACAGCAGAAAGGC
CYP2A6GTCAATCTCCTCATGGACCTTGGCCTGGTGATGACCACGTTGAAC
CYP2A7CGCTATGGCTTCTTGCTGCTCACTCCATGTAGGGCATCTTGGTC
CYP2B6ATGGGGCACTGAAAAAGACTGAAGAGGCGGGGACACTGAATGAC
CYP2C8GAGACAACAAGCACCACTCTGAGCAGTGTAAGGCATGTGGCTCCT
CYP2C9TCCTATCATTGATTACTTCCCGAACTGCAGTGTTTTCCAAGC
CYP3A4GCCTGGTGCTCCTCTATCTAGGTGTTGACCATCATAAAG
CYP3A43CTGCCTATGACACAACTAGCACCTACCAGGGCATCGTAGGTGACA
CYP3A7AAGTCTGGGGTATTTATGACTCGCTGGTGAATGTTGGAGAC
EPHX1GTTTTCCACCTGGACCAATACGGTGGTGCCTGTTGTCCAGTAGAG
PORACTCTGCTCTCGTCAACCAGCTTGGGTGCTTCTTGTTGGACTCC
PXRGGACCAGCTGCAGGAGCAATCATGAGGGGCGTAGCAAAGG
RDH16TATGGCGTGGAAGCCTTCTCTGGGTCCCAAATCTCCAGGAAGCT
RPLP0TCGACAATGGCAGCATCTACGCCTTGACCTTTTCAGCAAG
STEAP2CCTCTGCTTACCGATGAGAAGGCAGGAGGGAAAGTAAGCCAAGG
TAGLNTCCAGGTCTGGCTGAAGAATGGCTGCTCCATCTGCTTGAAGACC
TSKUAGTCGCTTGACCTCAGCCACAATCGTGAAGGCAGACACTGAGAC