TABLE 1

Primer sequences

GeneForward primerReverse primer
MRP1AGGACACGTCGGAACAAGTCGGAAGTAGGGCCCAAAGGTC
BΒ-ActinCATGTACGTTGCTATCCAGGCCTCCTTAATGTCACGCACGAT
Ubiquitin CEATGCGGGACTTCAAGAGGAGAAAATGACCGCGTTCCACAC