Quantitation ranges of volanesorsen and selected metabolite calibration curves for plasma and urine (mouse, monkey, and human)
Lower value defined as the lower limit of quantitation and upper value defined as the upper limit of quantitation. Boldface and underlined nucleotides are 2′-O-(2-methoxyethyl)-modified. All of the cytosines were 5-methylated.
| Compound Sequence | Description | Backcalculated Calibration Range | |||||
|---|---|---|---|---|---|---|---|
| Mouse Plasma | Monkey Plasma | Human Plasma | Mouse Urine | Monkey Urine | Human Urine | ||
| µg/ml | µg/ml | µg/ml | µg/ml | µg/ml | µg/ml | ||
| AGCTTCTTGTCCAGCTTTAT | Volanesorsen | 0.358–71.6 | 0.358–71.6 | 0.358–107.5 | 0.071–17.9 | 0.358–71.6 | 0.035–35.8 |
| AGCTTCTTGTCCAGCTTTA | 19-mer, 3′-deletion | 0.339–67.7 | 0.339–67.7 | 0.339–67.7 | 0.068–16.9 | 0.336–67.7 | 0.033–33.9 |
| AGCTTCTTGT | 10-mer, 3′-deletion | 0.178–35.5 | 0.176–35.5 | 0.178–53.3 | 0.036–8.88 | 0.176–35.5 | 0.017–17.8 |
| AGCTT | 5-mer, 3′-deletion | 0.096–19.3 | 0.096–19.3 | 0.482–28.9 | 0.096–9.63 | 0.096–19.3 | 0.009–9.63 |
| CCAGCTTTAT | 10-mer, 5′-deletion | 0.177–35.3 | 0.177–35.3 | 0.177–53.0 | 0.035–8.84 | 0.177–35.3 | 0.017–17.7 |
| TTTAT | 5-mer, 5′-deletion | 0.095–28.5 | 0.095–28.5 | 0.190–19.0 | 0.095–9.51 | 0.095–28.5 | 0.009–47.6 |