Association of some potential hormone response elements in human genes with the Alu family repeats

doi:10.1016/S0378-1119(99)00391-1

Gene

Volume 239, Issue 2, 1 November 1999, Pages 341-349

https://doi.org/10.1016/S0378-1119(99)00391-1 Get rights and content

Abstract

Short interspersed repeats of the Alu family located in promoters of some human genes contain high-affinity binding sites for thyroid hormone receptor, retinoic acid receptor and estrogen receptor. The standard binding sites for the receptors represent variants of duplicated AGGTCA motif with different spacing and orientation (direct, DR, or inverted, IR), and Alu sequences were found to have functional DR-4, DR-2 or variant IR-3/IR-17 elements. In this study we analyzed distribution and abundance of the elements in a set of human genomic sequences from GenBank and their association with Alu repeats. Our results indicate that a major fraction of potentially active DR-4, DR-2 and variant IR-3/IR-17 elements in the genes is located within Alu repeats. Alu-associated DR-2 elements are conserved in primate evolution. However, very few Alu have potential DR-3 glucocorticoid-response elements. Gel-shift experiments with the probe (AUB) corresponding to the consensus Alu sequence just upstream of the RNA polymerase III promoter B-box and containing duplicated AGGTCA motif indicate that the probe interacts in a sequence-specific manner with human nuclear proteins which bind to standard IR-0, DR-1, DR-4 or DR-5 elements. The AUB sequence was also able to promote thyroid hormone-dependent trans-activation of a reporter gene. The results support the view that Alu retroposons played an important role in evolution of regulation of the primate gene expression by nuclear hormone receptors.

Introduction

Transcription of eukaryotic genes is controlled by short conserved sequence blocks mostly located in 5′-flanking regions of genes, but also in introns and 3′-flanking regions (Koop and Hood, 1994). The blocks interact with components of the obligatory basal transcription machinery and with non-basal transcription factors initiating combinatorial transcriptional modulation of genes in specific cell lineages and in response to environmental signals. Many members of the large and important superfamily of transcription factors called nuclear hormone receptors (NHRs) recognize and bind to the promoter-associated hexamer block AGGTCA, and its duplicated variants with variable spacing and orientation — direct repeat, DR, or inverted repeat, IR (Mangelsdorf et al., 1990, Mangelsdorf et al., 1995, Umesono et al., 1991). For example, estrogen receptor (ER) binds as homodimer to an element IR-3 (inverted repeat with spacing 3 nt), receptors of the 9-cis-retinoic acid (RXRαβγ) preferentially bind to an element DR-1, receptors of the all-trans retinoic acid (RARαβγ) bind as heterodimers with RXR to elements IR-0 and DR-2,5, and thyroid hormone receptors (TRαβ) bind as heterodimers with RXR to elements IR-0 and DR-4 (Mangelsdorf and Evans, 1995, Mangelsdorf et al., 1995).

Many eukaryotic promoters carry the AGGTCA motif-containing DR or IR elements, suggesting that their transcription may be regulated by the NHRs. In most non-primate mammalian species these elements are embedded in variable sequence contexts. However, it has recently been found that in some human promoters functional DR-4 and DR-2 elements binding TR/RXR or RAR/RXR (Piedrafita et al., 1996, Toyoda et al., 1995, Vansant and Reynolds, 1995) and a variant IR-3/IR-17 element with high-affinity binding site for ER (Norris et al., 1995) are located within conserved sequences of Alu repeats which represent the most abundant family of ubiquitous human retroposons (Schmid and Maraia, 1992). Thyroid hormone response element (TRE) in the type I 5′-deiodinase (D1) gene provides a clear example of a functional Alu-associated element in the human gene promoter (Jakobs et al., 1997, Toyoda et al., 1995, Zhang et al., 1998). The promoter has distal (TRE2) and proximal (TRE1) elements, the first of which is a typical DR-4 element located within Alu repeat and the second is a variant DR-10 element. Both of them have been shown to contribute equally to the thyroid hormone (3,3′,5-triiodotyronine) induction of the promoter in a transient expression assay (Toyoda et al., 1995). It has been also shown recently (Nishikawa et al., 1998) that the level of the D1 mRNA in mononuclear blood cells in normal individuals is increased by the thyroid hormone in a dose-dependent manner, indicating that the promoter is directly activated by the hormone in situ.

Estrogen receptor-dependent upregulation of the BRCA1 mRNA in human breast cells in vivo (Romagnolo et al., 1998, Spillman and Bowcock, 1996) was shown to be mediated, at least in part, by an Alu-associated estrogen response element (ERE) (Norris et al., 1995) located within BRCA1 gene promoter β (Xu et al., 1997). The failure of the earlier attempt to reveal direct estrogen responsibility for the BRCA1 gene expression (Marks et al., 1997) was explained by an absence of the BRCA1 gene transcription initiation site in the plasmid constructs used in that attempt (Marks et al., 1997, Xu et al., 1997). A striking difference is observed in the structure of promoters of the mouse and human BRCA1 genes: exon 1B containing Alu-ERE and promoter β, present in the human gene, are absent from the corresponding mouse genomic sequence (Xu et al., 1997). Interestingly, an attempt to clone the most efficient human genomic EREs resulted in the isolation of a subset of Alu sequences (Norris et al., 1995) indicating that most of the EREs in human genes are associated with Alu repeats. Consensus sequence of the major subfamily of Alu repeats (AluSx) representing about 80% of all members of the family in the human genome (Batzer et al., 1996) contains motif AGGTCA located just upstream of the core element (B-box) of the internal RNA polymerase III (Pol III) promoter of the retroposons. The Alu segment covering this motif had previously been shown to contain DR-2 retinoic acid response element which binds RAR/RXR heterodimer (Vansant and Reynolds, 1995).

In this study we analyzed the distribution of potentially active DR-4, DR-2 and variant IR-3/IR-17 elements in a set of human genomic sequences, and their association with Alu repeats. The results of electrophoretic mobility shift assays (EMSA) indicate that the majority of DR-4, DR-2 and variant IR-3/IR-17 elements in human genes are associated with Alu repeats, and that HeLa cells contain Alu-binding proteins also interacting with consensus DR-1, DR-5 and IR-0 elements. An Alu-consensus element is able to support thyroid hormone-dependent trans-activation of luciferase reporter gene in a transient transfection assay.

Section snippets

Materials

All oligonucleotides used in this study in the electrophoretic mobility shift assays were synthesized at BioTeZ, Berlin-Buch. The upper-strand sequences of the oligonucleotides (5′ to 3′) were: (1) Alu-derived oligonucleotides (see Fig. 1 for their location in the major subfamily (AluSx) consensus sequence (Batzer et al., 1996) YAD — ccagcctgggcaacatggagaga, and AUB — atcacctgAGGTCAggagttcgag; (2) non-Alu oligonucleotides containing consensus high-affinity or mutated binding sites for specific

Nuclear hormone receptors of HeLa cells bind to a conserved Alu sub-sequence

To define the subregion important for the binding of nuclear hormone receptors in the major fraction of human Alu repeats, we used EMSA with the 24-mer oligonucleotide probe AUB corresponding to the segment of major subfamily Alu consensus sequence that contains the AGGTCA motif (Fig . 1). Sequence-specific complexes that are formed with this probe upon addition of HeLa nuclear extract (Fig. 2A) were completely supressed by an excess of unlabeled AUB oligonucleotide but not by another Alu

Acknowledgements

We would like to thank Professor R.M. Evans for sending us the indicated hormone receptor expression plasmids. This work was supported by joint grants of the Deutsche Forschungs Gemeinschaft (436 RUS 113/126/1) to S.L.O., the Russian Fund for Basic Research (96-04-000416 and 98-04-49665) to N.V.T.

References (38)

M.A. Batzer et al.
Standardized nomenclature for Alu repeats
J. Mol. Evol.
(1996)
M. Berry et al.
Estrogen-responsive element of the human pS2 gene is an imperfectly palindromic sequence
Proc. Natl. Acad. Sci. USA
(1989)
J.M. Blackwell et al.
Genetic regulation of macrophage activation: understanding the function of Nramp1
Immunol. Lett.
(1999)
R.J. Britten
Evidence that most human Alu sequences were inserted in a process that ceased about 30 million years ago
Proc. Natl. Acad. Sci. USA
(1994)
R.J. Britten
Mobile elements inserted in the distant past have taken on important functions
Gene
(1997)
J. Brosius et al.
On ‘genomenclature’: a comprehensive and respectful taxonomy for pseudogenes and other junk ‘DNA’
Proc. Natl. Acad. Sci. USA
(1992)
D.W. Burt et al.
Identification of negative and positive regulatory elements in the human renin gene
J. Biol. Chem.
(1989)
M.Y. Chiang et al.
An essential role for retinoid receptors RARbeta and RXRgamma in long-term potentiation and depression
Neuron
(1998)
P. D'Adamo et al.
Mutations in GDI1 are responsible for X-linked non-specific mental retardation
Nat. Genet.
(1998)
A.H. Danser et al.
Determinants of interindividual variation of renin and prorenin concentrations: evidence for a sexual dimorphism of (pro)renin levels in humans
J. Hypertension
(1998)

G.P. Holmquist

Chromatin self-organization by mutation bias

J. Mol. Evol.

(1994)

T.C. Jakobs et al.

The promoter of the human type I 5′-deiodinase gene-mapping of the transcription start site and identification of a DR+4 thyroid-hormone-responsive element

Eur. J. Biochem.

(1997)

S. Karlin et al.

Computational DNA sequence analysis

Annu. Rev. Microbiol.

(1994)

S. Kato et al.

Widely spaced, directly repeated PuGGTCA elements act as promiscuous enhancers for different classes of nuclear receptors

Mol. Cell. Biol.

(1995)

M.G. Kidwell et al.

Transposable elements as sources of variation in animals and plants

Proc. Natl. Acad. Sci. USA

(1997)

B. Koop et al.

Striking sequence similarity over almost 100 kilobases of human and mouse T-cell receptor DNA

Nat. Genet.

(1994)

A.L. Maia et al.

Is there a negative TRE in the luciferase reporter cDNA?

Thyroid

(1996)

D.J. Mangelsdorf et al.

The RXR heterodimers and orphan receptors

Cell

(1995)

D.J. Mangelsdorf et al.

Nuclear receptor that identifies a novel retinoic acid response pathway

Nature

(1990)

Cited by (61)

Corticosterone dynamically regulates retrotransposable element expression in the rat hippocampus and C6 cells
2021, Neurobiology of Stress
Citation Excerpt :
Transposable elements have appeared to co-evolved with host genomes and adapted to recognize host transcription factors (Rebollo et al., 2012; Sundaram et al., 2014). For instance, many Alu SINE elements, the primate specific B2 SINE-like analog, feature both direct and inverted steroid response motifs while others appear necessary for steroid receptor binding to motif “half-sites” (Babich et al., 1999; Bolotin et al., 2011; Polak and Domany, 2006; Jacobsen et al., 2009). Recent work has suggested an emerging role for transposable element RNA in regulating local inflammatory responses and housekeeping gene expression (Allen et al., 2004; Espinoza et al., 2004; Yakovchuk et al., 2009; Kaneko et al., 2011; Tarallo et al., 2012).
The hippocampus is a highly plastic brain region sensitive to environmental stress. It shows dynamic changes in epigenetic marks associated with stress related learning. Previous work has shown that acute stress induces substantial transient changes in histone H3 lysine 9 trimethylation (H3K9me3). Moreover, increased H3K9me3 is enriched in hippocampal gene deserts accumulating within endogenous retroviruses and transposable elements. We have found that in response to acute glucocorticoid treatment, a similar change in global H3K9me3 is observed. However, when localized we found that H3K9me3 is markedly decreased at B2 short interspersed nuclear elements but not within intracisternal-A particle endogenous retroviruses. Further, decreased H3K9me3 valence within B2 elements was associated with increased transcript abundance. These data demonstrate the capacity for acute glucocorticoids to mobilize transposable elements via epigenetic unmasking. Reconciled with previous findings following acute stress, this suggests the capacity for mobile elements to potentially function as novel regulators given their dynamic regulation by stress and glucocorticoids.
Regulation of human CYP11B1 and CYP11B2 promoters by transposable elements and conserved cis elements
2012, Steroids
Citation Excerpt :
However, increasing copy number also did not improve its enhancing effect. Although Alu had been reported to introduce hormonal regulation to host genes via the internal putative response motifs [22,23], the CYP11B1-Alu.2 element showed no response to cortisol/glucocorticoid receptor and estrogen/estrogen receptor in this study. How Alu modulates gene expression may vary under different genomic contexts.
CYP11B1 and CYP11B2 responsible for the final steps of cortisol and aldosterone synthesis, respectively, are believed to be duplicate genes with distinctive promoters. Our sequence analysis uncovers that these two genes share great homology in the proximal upstream regions, but insertion of Alu and L1 elements drives promoters divergent. Each CYP11B promoter contains two Alu elements embedded in a truncated L1 element, breaking L1 into three disconnected fragments. Alu functions as an enhancer in both genes regardless of orientation and copy number. Insertion of Alu upstream of a SV40 promoter also elevates promoter activity. However, the effect of Alu on CYP11B1 is blocked by a second L1 element (CYP11B1-L1.2) inserted between the first one and the conserved proximal upstream region. Although CYP11B1-L1.2 is 5′-truncated and lacks a functional ORF, replacing it with a fluorescent gene demonstrates that the element can be transcribed from the CYP11B1 core promoter in an opposite direction and a smaller magnitude compared to CYP11B1. Deletion of CYP11B1-L1.2 greatly increases CYP11B1 promoter activity and restores the enhancing effect of Alu. The Ad5 and SF-1 binding elements conserved in the proximal core promoter play a role in basal expression of both genes. Mutation of the Ad5 site reduces promoter activity to the minimal level. ERRα is the transcription factor interacting with Ad5 during basal expression. The core promoters of both genes are also conserved in mouse and rat despite the fact that the sites corresponding to cre, Ad5, and SF-1 in rodent Cyp11b1 promoters deviate from consensus.
Molecular diagnosis of two families with classic congenital adrenal hyperplasia
2011, Gene
Citation Excerpt :
However, it seemed unlikely, as there were only minor differences in the sequences 3.3 kb 5’ upstream of the initiation site of CYP21A2 and CYP21P. In addition, no differences were found in the AGGTCA motif (Babich et al., 1999; Ebihara et al., 2002) between the two genes. Another possibility might be that there was a defect in an adrenal cell-specific transcriptional factor that was necessary for the transcription of CYP21A2.
We investigated the genetic defects in two families with classic congenital adrenal hyperplasia (CAH). Clinical data and vein blood of the family members were collected, hormonal evaluation, karyotype analysis, ultrasound and CT scans were performed, and a direct-sequencing of PCR products of the candidate genes was used to identify the mutations. In family A, Patients A-II:1 and A-II:2 were found to be in a compound heterozygous state for mutations of p.I172N (g.1004 T > A) in exon 4 and IVS2-13A/C > G (g.659A/C > G) in intron 2 in CYP21A2 gene, their father A-I:1 and mother A-I:2 were found to carry a heterozygous mutation of IVS2-13A/C > G (g.659A/C > G) and p.I172N (g.1004 T > A) respectively. In family B, Patient B-II:1 was detected to carry only one heterozygous mutation of p.I172N; no other mutations in CYP11B1, CYP17A1 or HSD3B2 genes were detected. Her father B-I:1 carried a heterozygous mutation of p.I172N (g.1004 T > A) and her mother B-I:2 was found to be a wild type in all the candidate genes. Obviously, patients A-II:1 and A-II:2 inherited the p.I172N (g.1004 T > A)-bearing maternal allele and the IVS2-13A/C > G (g.659A/C > G)-bearing paternal allele. And this kind of compound heterozygous mutations caused simple virilising (SV) CAH. While patient B-II:1, whose phenotype was SV CAH too, was found to carry only one heterozygous mutation of the p.I172N (g.1004 T > A)-bearing paternal allele, and needed further studies.
Evolution of the repertoire of nuclear receptor binding sites in genomes
2011, Molecular and Cellular Endocrinology
Citation Excerpt :
The discovery of NR binding motifs within transposable elements such as the primate-specific Alu family of short-interspersed elements (SINEs) (Batzer and Deininger, 2002) has raised the possibility that part of the regulatory networks of the corresponding NRs may have evolved recently. Some of the potential binding sites for ERs (IR3) and RARs (DR2) identified in Alu repeats were demonstrated to be functional in reporter assays or chromatin immunoprecipitation studies (Babich et al., 1999; Laperriere et al., 2007; Norris et al., 1995). For instance, a perfect consensus VDRE identified in the flanking sequences of the human cathelicidin antimicrobial peptide (CAMP) and found to confer in vivo binding by VDR and vitamin D regulation to the CAMP promoter (Wang et al., 2004) resulted from the insertion of an AluSx SINE (Gombart et al., 2005).
Nuclear receptors (NRs) are ligand-dependent transcription factors with important roles in normal development and physiology and in a wide array of pathologies. While identification of natural or synthetic ligands for all human NRs has clarified their physiological roles and led to numerous therapeutic applications, much remains to be understood about the mechanisms by which NRs control transcription of specific networks of target genes. The DNA binding domain, composed of two C4 type zinc fingers, is the most conserved region in NRs. Binding motif selectivity stems from variations in dimerization interfaces in the DNA and ligand binding domains as well as from divergence in a few base-contacting residues in the first zinc finger. However, overlaps in DNA binding patterns suggest competition between different NRs at target sites in vivo, resulting in cross-regulation of subsets of target gene networks. As NRs can regulate transcription even when bound far from the transcription initiation sites of target genes, the considerable expansion in intergenic DNA in genomes throughout evolution likely contributes to the diversity and complexity of tissue-specific gene regulation by NRs. In particular, the presence of NR binding sites in the primate-specific Alu family of short-interspersed elements has been shown to confer transcriptional regulation by NRs to adjacent genes, although the impact on NR regulatory networks at the genome-wide scale remains to be more fully evaluated.
Intelligent design and biological complexity
2006, Gene
Before any intelligence can appear, a world endowed with the potential for being experienced as a body of phenomena has to be existent. Indeed, if there is to be an intelligence, there first has to be something intelligible. Hence, when an intelligence is present, “creation” must already have taken place. Nevertheless, biological complexity has been deemed by some to be one of the privileged points of insertion of a supernatural intelligence endowed with temporal and causal primacy. In the course of a critical review, it is pointed out that the spectacle of nature's spontaneous tinkering with the structures and performances of informational macromolecules and with interactive connections among these molecules suggests that intelligence and design are absent from evolution. Nor is intelligent design required for explaining biological complexity, which can increase spontaneously as a byproduct of combinatorial intermolecular gambles and of the restoration of molecular damage wrought by mutations. One of the possible molecular pathways to spontaneous evolutionary increases in complexity is described.
Introns and Their Therapeutic Applications in Biomedical Researches
2023, Iranian Journal of Biotechnology

View all citing articles on Scopus

View full text

Association of some potential hormone response elements in human genes with the Alu family repeats

Abstract

Introduction

Section snippets

Materials

Nuclear hormone receptors of HeLa cells bind to a conserved Alu sub-sequence

Acknowledgements

Standardized nomenclature for Alu repeats

J. Mol. Evol.

Estrogen-responsive element of the human pS2 gene is an imperfectly palindromic sequence

Proc. Natl. Acad. Sci. USA

Genetic regulation of macrophage activation: understanding the function of Nramp1

Immunol. Lett.

Evidence that most human Alu sequences were inserted in a process that ceased about 30 million years ago

Proc. Natl. Acad. Sci. USA

Mobile elements inserted in the distant past have taken on important functions

Gene

On ‘genomenclature’: a comprehensive and respectful taxonomy for pseudogenes and other junk ‘DNA’

Proc. Natl. Acad. Sci. USA

Identification of negative and positive regulatory elements in the human renin gene

J. Biol. Chem.

An essential role for retinoid receptors RARbeta and RXRgamma in long-term potentiation and depression

Neuron

Mutations in GDI1 are responsible for X-linked non-specific mental retardation

Nat. Genet.

Determinants of interindividual variation of renin and prorenin concentrations: evidence for a sexual dimorphism of (pro)renin levels in humans

J. Hypertension

Chromatin self-organization by mutation bias

J. Mol. Evol.

The promoter of the human type I 5′-deiodinase gene-mapping of the transcription start site and identification of a DR+4 thyroid-hormone-responsive element

Eur. J. Biochem.

Computational DNA sequence analysis

Annu. Rev. Microbiol.

Widely spaced, directly repeated PuGGTCA elements act as promiscuous enhancers for different classes of nuclear receptors

Mol. Cell. Biol.

Transposable elements as sources of variation in animals and plants

Proc. Natl. Acad. Sci. USA

Striking sequence similarity over almost 100 kilobases of human and mouse T-cell receptor DNA

Nat. Genet.

Is there a negative TRE in the luciferase reporter cDNA?

Thyroid

The RXR heterodimers and orphan receptors

Cell

Nuclear receptor that identifies a novel retinoic acid response pathway

Nature