Journal of Pharmacological and Toxicological Methods
Original articleEffect of buffer components and carrier solvents on in vitro activity of recombinant human carboxylesterases
Introduction
While the carboxylesterases (CEs) are important for xenobiotic detoxification and prodrug activation (Satoh & Hosokawa, 2006), these enzymes have not been studied as extensively as other Phase I enzymes, such as the cytochrome P450s. However, interest in the CE family has increased in recent years, due in part to the sequencing of the genomes of many species and continued pursuits at understanding the structural elements of their active sites involved in hydrolysis (Bencharit et al., 2006) and substrate selectivity (Imai, 2006). The CEs are a multigene family of serine hydrolase enzymes found in organisms ranging from bacteria to mammals (Redinbo & Potter, 2005). These enzymes hydrolyze compounds containing ester, amide, or thioester linkages. In mammals, the substrates are both endogenous (i.e., acyl-glycerols and acyl-CoA esters) and exogenous (i.e., cocaine and heroin).
Interest in the CEs range from the design of herbicides with selective toxicity (Gershater, Sharples, Edwards, 2006) to the potential treatment for drug overdose, addiction, and chemical warfare, as well as prodrug therapy (Redinbo & Potter, 2005). It has been proposed that an engineered CE could be injected to reduce cocaine exposure quickly, while a CE inhibitor could be administered to decrease the conversion of heroin to its active metabolite, morphine (Redinbo & Potter, 2005). CEs are required for the activation of a number of prodrugs, such as irinotecan (CPT-11), an anti-cancer agent, which is converted to its active metabolite SN-38 (Humerickhouse, Lohrbach, Li, Bosron, Dolan, 2000). On the other hand, some drugs, such as aspirin and clopidogrel (Tang et al., 2006), are inactivated by hydrolysis. Thus, a thorough understanding of these enzymes could assist endeavors ranging from agricultural to medicinal pursuits.
To understand fully the CE enzymes, a routine and robust in vitro system to measure catalytic activity would provide significant insight into the interactions between the enzymes and their substrates. While the CEs are typically found bound to the endoplasmic reticulum (Satoh & Hosokawa, 2006), in some species a soluble form is also known to circulate in the plasma (Li et al., 2005). When a membrane-bound form of human CES1 is expressed as a soluble form, there does not appear to be an alteration in the activity of the enzyme (Scott, Chacko, Maxwell, Schlager, Lanclos, 1999). An example of the benefit of an in vitro system to elucidate the full kinetics between a substrate and CE is that of prasugrel with human CES2 (Williams et al., 2007). Unique kinetics are observed with the purified CES2 enzyme at high substrate concentrations that are not observed in vivo. Therefore, significant benefits exist for conducting in vitro assays to further knowledge of the pharmacological and potential toxicological significance.
Each mammalian species may have several CE forms that are expressed throughout the organism, with each form having some tissue-specific expression. In humans, three forms of CEs (CES1, CES2, and CES3) have been identified and two other genes (CAUXIN — carboxylesterase-like urinary excreted protein and AADAC-arylacetamide deacetylase) have been recently added as potential CEs (Satoh & Hosokawa, 2006). Two of the forms (CES1 and CES2) have undergone extensive investigation, and both have their highest mRNA expression in the liver (Satoh et al., 2002). Extrahepatic mRNA expression of CES1 has been detected in the stomach, testis, kidney, spleen, and colon, in decreasing order (Satoh et al., 2002). On the other hand, extrahepatic CES2 mRNA has also been identified in the colon, small intestine, and heart, in decreasing order. While CES3 was initially cloned from the brain (Mori, Hosokawa, Ogasawara, Tsukada, Chiba, 1999), its mRNA is expressed in the liver (Quinney et al., 2005), but its protein expression has not been shown since an antibody does not yet exist.
To date, there has not been a report systematically determining the incubation conditions that yield the highest intrinsic clearance when conducting in vitro metabolism experiments with the human CE forms. In the literature, an inconsistent use of incubation conditions is found, including 50 mM sodium phosphate (Böttcher, Brüsehaber, Doderer, Bornscheuer, 2007); 90 mM KH2PO4 and 40 mM KCl; 50 mM NaH2PO4 (Pindel et al., 1997); 50 mM HEPES (Scott et al., 1999); and 20 mM Tris (Nishi et al., 2006). In theory, these enzymes only require an aqueous environment in which to function (Satoh & Hosokawa, 2006). Thus, the current study considers the impact of four major variables of in vitro assay conditions, reaction buffer, substrate solvent, and the relative concentrations of each, that affect substrate hydrolysis in vitro by the human CEs.
Section snippets
Expression and purification of recombinant protein
CES1 cDNA was obtained by PCR from human liver cDNA (cat. no. 639307; BD Biosciences Clontech; Mountain View, CA) using PfuTurbo DNA polymerase (cat. no. 600250; Stratagene; La Jolla, CA) with a 5' primer (CGAGAACTGTCGCCCTTCCACGAT) and 3' primer (CAGACAATTCCCCAGCCATGGTAAGATG). Supplemental Fig. 1 contains the cDNA sequence obtained for CES1. The cDNAs for CES2 and CES3 were purchased from OpenBiosystem Co. (cat. no. MHS1011-7508842; Huntsville, AL) and Invitrogen (cat. no. 6145696; Carlsbad,
Results and discussion
Since the goal of this work was to arrive at robust assay conditions to routinely determine the catalytic activity of the CEs, the use of a single probe substrate is consistent with the recommendation made by PhRMA for several Phase I and Phase II enzymes (Bjornsson et al., 2003). Of the probe substrates used for the CEs, two common probe substrates of multiple forms are 4-nitrophenyl acetate (Li et al., 2005, Ross et al., 2006) and 4-nitrophenyl butyrate (4-NPB) (Soni et al., 2004, Ross et
Acknowledgments
The authors thank Barbara Ring, Michael Mohutsky, and Kevin Guo (Eli Lilly and Company) for their thoughtful discussion of the work, Jingqi Bao and Doreen Gillespie (Eli Lilly and Company) for their technical assistance, and Henry Strobel (University of Texas Health Science Center at Houston) for his editorial assistance. All funding was provided by Eli Lilly and Company.
References (22)
- et al.
Multisite promiscuity in the processing of endogenous substrates by human carboxylesterase 1
Journal of Molecular Biology
(2006) - et al.
Carboxylesterase activities toward pesticide esters in crops and weeds
Phytochemistry
(2006) Human carboxylesterase isozymes: Catalytic properties and rational drug design
Drug Metabolism Pharmacokinetics
(2006)- et al.
High rates of substrate hydroxylation by human cytochrome P450 3A4 in reconstituted membranous vesicles: Influence of membrane charge
Biochemical and Biophysical Research Communications
(1996) - et al.
Butyrylcholinesterase, paraoxonase, and albumin esterase, but not carboxylesterase, are present in human plasma
Biochemical Pharmacology
(2005) - et al.
Effect of alcohols on the hydrolysis catalyzed by human pancreatic carboxylic-ester hydrolase
Biochimica Et Biophysica Acta
(1981) - et al.
cDNA cloning, characterization and stable expression of novel human brain carboxylesterase
FEBS Letters
(1999) - et al.
Characterization of pyrethroid hydrolysis by the human liver carboxylesterases hCE-1 and hCE-2
Applied Microbiology and Biotechnology
(2006) - et al.
Purification and cloning of a broad substrate specificity human liver carboxylesterase that catalyzes the hydrolysis of cocaine and heroin
Journal of Biological Chemistry
(1997) - et al.
Mammalian carboxylesterases: From drug targets to protein therapeutics
Drug Discovery Today
(2005)
Hydrolytic metabolism of pyrethroids by human and other mammalian carboxylesterases
Biochemical Pharmacology
Cited by (22)
Human carboxylesterase 2: Studies on the role of glycosylation for enzymatic activity
2016, Biochemistry and Biophysics ReportsCitation Excerpt :The inhibitors were added prior to substrate addition. Final DMSO concentration in the reaction mixture never exceeded 1% (v/v) in order not to affect hCES catalytic activity [33]. Supernatant samples were subjected to a non-linear temperature gradient using a BioRad IQ Cycler IQ5 (Bio-Rad, USA) for 3 min.
Molecular reproductive characteristics of the reef coral Pocillopora damicornis
2015, Comparative Biochemistry and Physiology -Part A : Molecular and Integrative PhysiologyCitation Excerpt :Fluorescent assays were performed in solid black, flat-bottomed plates and colorimetric assays in clear plates. When necessary, substrates were dissolved in solvents (DMSO and methanol), which were never more than 2% of the reaction volume; hence, solvent carrier properties should not have affected enzyme activities (Williams et al., 2008). Microplates were read using either a Spectra Max 340 Plus or Gemini XS (Molecular Devices, Sunnyvale, CA).
Efficient in vitro refolding and functional characterization of recombinant human liver carboxylesterase (CES1) expressed in E. coli
2015, Protein Expression and PurificationCitation Excerpt :Wild-type (WT) as well as mutant proteins have been expressed and investigated with regard to hydrolysis, metabolism and activation of several compounds mediated by CES1, such as p-nitrophenyl acetate (pNPA), oseltamivir, methylphenidate, trandolapril and clopidogrel and its metabolite [6–10]. Insect cells, Sf9 and Sf21, are also preferred for expressing CES1, which is accomplished using a baculovirus expression system [2,3,11,12]. In addition to insect cell culture, there was a report in which Trichoplusia ni whole-insect larvae were used as a production source of CES1 recombinant protein [13].
Percutaneous absorption of herbicides derived from 2,4-dichlorophenoxyacid: Structure-activity relationship
2014, Toxicology in VitroCitation Excerpt :The mixture was homogenised with an Ultra-Turax blender (IKA-Werke, Staufen, Germany) by 2 × 30-s bursts separated by a 30-s rest period. The esterase activity in each skin homogenate was determined by measuring absorption at 405 nm, indicative of NP formation as a result of NPBut hydrolysis at 37 °C (Heymann et al., 1993; Williams et al., 2008). A stock solution of NPBut (2 mM) was prepared extemporaneously by solubilising 5.3 μL of pure NPBut in 100 μL of a Cremophore®/ethanol mixture (50/50 v/v) (Williams et al., 2008).
Genomic analysis of the carboxylesterases: Identification and classification of novel forms
2010, Molecular Phylogenetics and Evolution