Genomic analysis of the carboxylesterases: Identification and classification of novel forms
Introduction
Carboxylesterases (CEs) are a multigene family of enzymes that hydrolyze compounds containing an ester, amide, or thioester linkage. This reaction may be reversible, with transesterification facilitated by human CE1 (Dean et al., 1991, Imai, 2006). Substrates include endogenous (i.e., acyl-glycerols and acyl-CoA esters) and exogenous (i.e., cocaine and heroin) agents (Imai, 2006). These enzymes are important in the biotransformation of numerous pharmaceutical agents, and play a critical role in the activation of many prodrugs (Redinbo and Potter, 2005). As with other families of biotransformation enzymes, there are significant species-related differences in the expression and substrate specificity of CE enzymes. Consequently, this interspecies diversity and the lack of a consistently used broad system of classification for CE-related genes complicates the preclinical evaluation of ester-containing pharmaceutical agents and toxicants.
Much of the early nomenclature for esterases was based on enzyme characteristics, such as tissue expression, substrate specificity, enzyme size, and pI value. The utility of this approach for CEs is hindered by the high degree of substrate overlap between CE forms and the existence of multiple closely related genes in some species. A homology-based mammalian CE nomenclature system has been proposed (Satoh and Hosokawa, 2006) that joins five enzyme groups, described as CES1, CES2, CES3, CES4, and CES5, to form a carboxylesterase superfamily. The proposed CES1 and CES2 groups were the first discovered mammalian CEs (Satoh and Hosokawa, 1998), followed by the CES3 forms (Mori et al., 1999). The proposed CES4 group comprises CAUXIN (CArboxylesterase-like Urinary eXcreted proteIN) (Miyazaki et al., 2003). Another set of enzymes, arylacetamide deacetylases (AADAC), was proposed as a CES5 group (Satoh and Hosokawa, 2006). While this classification system is useful, it does not provide a sufficiently broad genome-based framework to enable cross-species comparisons and is somewhat inconsistent with other xenobiotic metabolizing enzyme classification systems, such as that adopted for use with the cytochromes P450 (Nelson et al., 1996).
Recent publications have provided additional insight into the phylogenetic and evolutionary relationships of CEs. Through examination of opossum and primate CE sequences, a case has been made for the existence of multiple CEs prior to the appearance of mammals (Holmes et al., 2008a, Holmes et al., 2009). By carefully examining the current genomic databases, the discovery of additional CE-related genes can be greatly accelerated and potential pseudogenes can be identified. The current study aims to improve the understanding of species relatedness of CEs by taking advantage of recent advances in genomic sequencing. The genomes of the chicken, chimpanzee, cow, dog, horse, human, medaka, mouse, opossum, orangutan, rat, rhesus monkey, stickleback, tetraodon, and zebrafish were analyzed for the presence of CE genes. The discovered CE-related sequences were compiled and compared to determine interrelatedness and avoid assigning multiple identities to the same gene. This study has elucidated the sequences for many novel CE-related genes, gives further insight into the evolutionary lineage of human CEs, and provides considerations for a genomic-based system of nomenclature of serine hydrolases.
Section snippets
Cloning from the dog and cynomolgus monkey
The clones of the CE1 and CE2 genes from the dog and cynomolgus monkey were obtained by PCR using PfuTurbo DNA polymerase (Cat. No. 600250; Stratagene; La Jolla, CA). Dog CE1 cDNA was cloned from liver total RNA (Cat. No. R1734149; BioChain Institute, Inc.; Hayward, CA) using forward and reverse primers of CACGATGTGGCTCTTCGATCTGGTCCT and CATCCCAACCTCCACAGTAAGATCCCTC, respectively. The dog CE2 was cloned from brain total RNA (Cat. No. R1734035-50; BioChain Institute, Inc.) using forward and
Results
The initial phase of this study utilized the previously identified human CE genes as the basis for further exploration. Based upon the known CE sequences, the CE1 and CE2 forms were cloned and sequenced from two frequently used large animal models, the dog and cynomolgus monkey. The nucleotide and deduced amino acid sequences are listed in Supplementary Figs. 1–5.
The genomes of the chicken, chimpanzee, cow, dog, horse, human, medaka, mouse, opossum, orangutan, rat, rhesus monkey, stickleback,
Discussion
The evidence indicates that the CEs are best described as a family of enzymes within a larger superfamily of serine hydrolases, with distinct subfamilies that appear to have evolved with divergent endogenous functions.
Conclusions
This study presents data supporting that the CEs are a family of enzymes consisting of several subfamilies, and are part of the larger serine hydrolase superfamily based on genomic evidence. In addition to previously established phylogenetic algorithms, the use of gene structure in the current analyses showed a significant benefit to gene classification. The gene structure agreed with the grouping of the subfamilies based on nucleotide and amino acid sequence similarities. Also, the similarity
Acknowledgment
The authors thank Yingying Guo, Eli Lilly and Company, for her thoughtful discussion of the work.
References (35)
- et al.
Mammalian carboxylesterase 5: comparative biochemistry and genomics
Comp. Biochem. Physiol. D Genomics Proteomics
(2008) Human carboxylesterase isozymes: catalytic properties and rational drug design
Drug Metab. Pharmacokinet.
(2006)- et al.
Species-, sex-, and age-dependent urinary excretion of cauxin, a mammalian carboxylesterase
Comp. Biochem. Physiol. B Biochem. Mol. Biol.
(2006) - et al.
CDNA cloning, characterization and stable expression of novel human brain carboxylesterase
FEBS Lett.
(1999) - et al.
Mammalian carboxylesterases: from drug targets to protein therapeutics
Drug Discov. Today
(2005) - et al.
Structure, function and regulation of carboxylesterases
Chem. Biol. Interact.
(2006) - et al.
Molecules consolidate the placental mammal tree
Trends Ecol. Evol.
(2004) - et al.
Nuclear receptors and drug disposition gene regulation
J. Pharm. Sci.
(2005) - et al.
Effect of buffer components and carrier solvents on in vitro activity of recombinant human carboxylesterases
J. Pharmacol. Toxicol. Methods
(2008) - et al.
Defining relationships between the known members of the cytochrome P450 3A subfamily, including five putative chimpanzee members
Mol. Phylogenet. Evol.
(2004)
Structural insights into CPT-11 activation by mammalian carboxylesterases
Nat. Struct. Biol.
The molecular evolution of genes and proteins: a tale of two serines
Nature
Relationship between sequence conservation and three-dimensional structure in a large family of esterases, lipases, and related proteins
Protein Sci.
CAFE: a computational tool for the study of gene family evolution
Bioinformatics
Human liver cocaine esterases: ethanol-mediated formation of ethylcocaine
FASEB J.
Atlas of Protein Sequence and Structure
An epididymal form of cauxin, a carboxylesterase-like enzyme, is present and active in mammalian male reproductive fluids
Biol. Reprod.
Cited by (0)
- 1
Present address: Eisai, Inc., 4 Corporate Drive, Andover, MA 01810, USA.