Article Figures & Data
Figures
- Fig. 1.
Chemical structures of statins and statin metabolites investigated in the present work. The dihydroxyheptanoic acid functionality is highlighted in gray.
- Fig. 2.
Experimental paradigms for the measurements of steady-state tissue cholesterol levels (A), tissue uptake of dietary cholesterol (B), and tissue cholesterol input comprised of local cholesterol biosynthesis and tissue uptake of the synthesized cholesterol from the systemic circulation (C). The number of animals (n) for each experiment is indicated in parenthesis. CF, rodent chow containing 0.3% cholesterol and 10% peanut oil; D7-CF, rodent chow containing 0.3% deuterated cholesterol and 10% peanut oil; D2O, deuterated water.
- Fig. 3.
Quantifications of different statins in mouse serum (A) and retina (B) after a single-dose (60 mg/kg body weight) drug administration by oral gavage (n = 3 mice or 6 eyes per statin). ATR, atorvastatin; 2-HATR, 2-hydroxyatorvastatin; np and p, the retinas of nonperfused and perfused mice, respectively; ND, nondetectable (the limit of drug detection is 0.1 pmol/retina or 20 pmol/ml serum); N-DROS, N-desmethylrosuvastatin; PRV, pravastatin; ROS, rosuvastatin; SHA, simvastatin hydroxyacid; SIM, simvastatin. All data represent the means ± S.D. of the measurements in individual mice.
- Fig. 4.
Quantifications of simvastatin (SIM) and simvastatin hydroxyacid (SHA) in the serum (A), retina (B), and brain (C) of mice after the 6-week simvastatin administration (60 mg/kg body weight/day) by oral gavage (n = 3 mice or 6 eyes per statin). ND, nondetectable (the limit of drug detection is 20 pmol/ml of serum, 0.1 pmol/retina, and 0.05 pmol/mg brain protein). All data represent the means ± S.D. of the measurements in individual mice.
- Fig. 5.
Sterol quantifications in the serum (A), retina (B), and brain (C) of mice after the 6-week simvastatin administration (60 mg/kg body weight/day) by oral gavage (n = 6 mice per treatment group). SIM, simvastatin-treated mice; VEH, vehicle-treated mice. All data represent the means ± S.D. of the measurements in individual mice. Asterisks are statistically significant changes relative to the vehicle-treated group as assessed by a two-tailed, unpaired Student’s t test (*P ≤ 0.05; ***P ≤ 0.001).
- Fig. 6.
Relative tissue enrichment with D7-cholesterol in the serum (A), retina (B), and brain (C) of mice fed for 2 weeks with rodent chow containing 0.3% D7-cholesterol and 10% peanut oil (Fig. 2B). All data represent the means ± S.D. of the measurements in individual mice. Asterisks are statistically significant changes relative to the vehicle-treated group as assessed by a two-tailed, unpaired Student’s t test (**P ≤ 0.01; ***P ≤ 0.001). SIM, simvastatin-treated mice; VEH, vehicle-treated mice.
- Fig. 7.
Relative tissue cholesterol enrichment with 2H in the serum (A), retina (B), and brain (C) of mice maintained for 2 weeks on 6% D2O (Fig. 2C). All data represent the means ± S.D. of the measurements in individual mice. Asterisks are statistically significant changes relative to the vehicle-treated group as assessed by a two-tailed, unpaired Student’s t test (***P ≤ 0.001). SIM, simvastatin-treated mice; VEH, vehicle-treated mice.
- Fig. 8.
Retinal gene expression in mice after the 6-week simvastatin administration (60 mg/kg body weight/day) by oral gavage. All data represent the means ± S.D. of triplicate measurements on a pooled sample of individual retinas from five mice. Since the error bars represent the technical variability of the measurements, statistical significance of changes in the gene expression could not be assessed. SIM, simvastatin-treated mice; VEH, vehicle-treated mice.
Tables
Gene Forward Primer (5′ to 3′) Reverse Primer (5′ to 3′) Cd36 TACAGAAGACCTGGGCTTGG GAGAGGCGGGCATAGTATCA Gapdh AGTCCATGCCATCACTGCCACC CCAGTGAGCTTCCCGTTCAGC Ldlr ACCTGCCGACCTGATGAATTC GCAGTCATGTTCACGGTCACA Scarb1 TTGGCCTGTTTGTTGGGATG ATCGATCTTGCTGAGTCCGT Srebp2 ATGATCACCCCGACGTTCAG GGTCGCTGCGTTCTGGTATATC Line # Parameter Serum Retina Brain VEH SIM VEH SIM VEH SIM Cholesterol content 1 Serum, mg/dl; retina and brain, nmol/mg protein 163 132 64.4 48.8 271 265 2 µg/g wet tissue 2576 1952 12,163 11,893 Treatment with dietary D7-cholesterol 3 D7-cholesterol appearance, 2 wk, % 37 47 1.5 1.8 0.2 0.2 4 Tissue cholesterol uptake, 2 wk, % 3.8 3.8 0.5 0.5 Treatment with deuterated water 5 Total 2H cholesterol enrichment, 2 wk, % 16 12 16 9 13 12 6 2H cholesterol enrichment from tissue uptake, 2 wk, % 0.7 0.5 0.09 0.06 7 Tissue cholesterol biosynthesis, 2 wk, % 15.3 8.5 12.9 11.9 Summary data 8 Absolute rate of cholesterol input, μg/day/g wet tissue (%) 35.7 (100) 17.2 (100) 116.9 (100) 106.0 (100) 9 Local biosynthesis, μg/day/g wet tissue (%) 28.2 (79) 11.9 (69) 112.2 (96) 101.4 (96) 10 Uptake from blood, μg/day/g wet tissue, (%) 7.5 (21) 5.3 (31) 4.7 (4) 4.6 (4) 11 Tissue cholesterol turnover, days 72 113 104 112 SIM, simvastatin-treated mice; VEH, vehicle-treated mice.
In this issue
Statins and the Retina
