Article Figures & Data
Figures
- Fig. 1.
Differential gene expression in PHHs following incubation with EGF. (A) DIGIWest analysis of protein expression in PHHs (Liv10, Table 1) following incubation or not with 10 ng/ml EGF for 5 days. (B) Number of upregulated genes and enriched pathways in EGF-treated PHHs [false discovery rate (FDR) = 4.7 × 10−18–1.9 × 10−5]. (C) Number of downregulated genes and enriched pathways in EGF-treated PHHs (FDR = 8.8 × 10−10–0.008). (D) Heat map showing the genes differentially expressed in PHHs (n = 5) following incubation with EGF.
- Fig. 2.
EGF influences specifically the expression of CAR and its target genes in PHHs. PHHs from two donors (Liv1 and Liv2, Table 1) were incubated with 1 µM CITCO, 0.5 mM PB, or dimethylsulfoxide (DMSO) (UT) for 24 hours in the absence or presence of 10 ng/ml EGF. EGF was added before [day 0 (D0)] or together [day 2 (D2)] with the inducers. The relative expression of CAR (A), CYP2B6 (B), and CYP3A4 (C) mRNA was measured by qPCR and normalized to RPLP0. Results are expressed relative to control (UT) in medium without EGF; *P < 0.05; **P < 0.01, relative to control (no EGF) in the same treatment group; #P < 0.05; ##P < 0.01, relative to control (UT).
- Fig. 3.
CAR depletion inhibits CYP2B6 induction by PB and CITCO only in the absence of EGF. PHHs from five donors (Liv3–7) were transfected with control (siCT) or CAR-targeting siRNAs (siCAR). Then they were incubated with 0.5 mM PB and 1 µM CITCO or DMSO (UT) for 24 hours, with or without 10 ng/ml EGF (from D0). The relative expression of CAR (A) and CYP2B26 (B) mRNA was measured by qPCR and normalized to RPLP0. Results are expressed relative to UT in siCT-transfected cells in the absence of EGF. (C) CYP2B6 protein level was assessed by Western blotting (representative experiment using PHHs from Liv12). GAPDH protein expression was used as loading control. Results are expressed relative to control (UT) in medium without EGF; ***P < 0.005, relative to control (siCT) in the same treatment group; ###P < 0.005, relative to control (UT).
- Fig. 4.
EGF differentially affects the response to CITCO and PB. Venn diagrams showing the overlap of genes that are differentially expressed in PHHs from five donors (Liv3–7) upon incubation with 1 µM CITCO (A) or 0.5 mM PB (B) in the absence or presence of 10 ng/ml EGF (from D0). The number of up- and downregulated genes in each experimental condition is indicated in red and green, respectively.
- Fig. 5.
KEGG pathway enrichment, relative to untreated cells, of siCT-transfected PHHs from five donors (Liv3–7) incubated with 0.5 mM PB (A) or 1 µM CITCO (B) for 24 hours in the presence or absence of 10 ng/ml EGF (from D0).
- Fig. 6.
PHHs from two donors (Liv6 and Liv7, Table 1) were transfected with control (siCT) or CAR-targeting siRNAs (siCAR). They were then incubated with 0.5 mM PB, 1 µM CITCO, or DMSO (UT) for 24 hours, in the presence or not of 10 ng/ml EGF (from D0). The relative expression of CYP2A6 (A), CYP2A7 (B), CYP3A4 (C), CYP3A43 (D), CYP3A7 (E), CYP2C8 (F), CYP2C9 (G), TSKU (H), EPHX1 (I), POR (J), ALAS1 (K), TAGLN (L), STEAP2 (M), and CEBP3 (N) mRNA was measured by qPCR and normalized to RPLP0. Results are expressed relative to not treated siCT-transfected PHHs (UT) in medium without EGF. *P < 0.05; **P < 0.01, relative to control in the same treatment group; ##P < 0.01; ###P < 0.005, relative to control (UT).
- Fig. 7.
PHHs from five donors (Liv3–7, Table 1) were transfected with control (siCT), CAR-targeting (siCAR), or PXR-targeting (siPXR) siRNAs. Then they were incubated with 0.5 mM PB, 1 µM CITCO, or DMSO (UT) for 24 hours in the presence or not of 10 ng/ml EGF (from D0). The relative expression of PXR (A), CAR (B), CYP2B6 (C), or CYP3A4 (D) mRNA was measured by qPCR and normalized to RPLP0. Results are expressed relative to not treated siCT-transfected PHHs (UT) in medium without EGF. PHHs from Liv16 were transfected with siCT, siCAR and/or siPXR siRNAs. Then, they were incubated with 0.5 mM PB or DMSO for 24 hours, in the presence of 10 ng/ml EGF (from D0). The relative expression of CAR and PXR (E), CYP2B6, CYP3A4, TSKU, CYP2C8, CYP2A6, CYP2A7, CYP3A43 (F) mRNA was measured by qPCR and normalized to RPLP0 expression level. Results are expressed relative to not treated siCT-transfected PHHs in medium with EGF (white bars). *P < 0.05; **P < 0.01; ***P < 0.001 relative to control in the same treatment group.
- Fig. 8.
PHHs from eight donors (Liv3–7 and 13–15, Table 1) were incubated with 0.5 mM PB, 1 µM CITCO, or DMSO (UT) for 24 hours in the presence or not of 10 ng/ml EGF (from D0). The relative expression of CYP2B6 was measured by qPCR and normalized to RPLP0 in the absence (A) or presence (C) of EGF. PXR/CAR mRNA expression ratio in the absence (B) or presence (D) of EGF (expressed as LOG10). PHHs from two donors (Liv13 and Liv15, Table 1) (E and F) were transfected with control (siCT), CAR-targeting (siCAR), or PXR-targeting (siPXR) siRNAs. They were then incubated with 0.5 mM PB, 1 µM CITCO, or DMSO (UT) for 24 hours in the presence or not of 10 ng/ml EGF (from D0). The relative expression of CYP2B6 was measured by qPCR and normalized to RPLP0 in the absence or presence of EGF. Results are expressed relative to not treated siCT-transfected PHHs (UT) in medium without EGF. *P < 0.05; **P < 0.01; ***P < 0.001.
Tables
Liver Origin Age (yr) Sex Pathology Liv1 Donor 41 M Anoxia Liv2 Biopredic Intl 78 F Hepatocellular carcinoma Liv3 Resection 66 F Metastasis from colon cancer Liv4 Donor 69 F Renal cyst Liv5 Donor 53 M Stroke Liv6 Resection 76 M Metastasis from colon cancer Liv7 Resection 45 F Polycystic liver disease Liv10 Biopredic Intl 72 M Hepatocellular carcinoma Liv12 Resection 78 F Cholangiocarcinoma Liv13 Donor 59 M Meningeal hemorrhage Liv14 Donor 60 M Stroke Liv15 Donor 55 M Stroke Liv16 Resection 67 F Metastasis from colon cancer Gene Forward Primer Reverse Primer ALAS1 GATGTCAGCCACCTCAGAGAAC CATCCACGAAGGTGATTGCTCC CAR TGCTGCCTCTGGTCACACAC CCCGCAGAGGAAGTTTTGTG CPEB3 GGTGTTTGTTGGAGGACTTCCTC CCTCTTGGAACAGCAGAAAGGC CYP2A6 GTCAATCTCCTCATGGACCTTGG CCTGGTGATGACCACGTTGAAC CYP2A7 CGCTATGGCTTCTTGCTGCTCA CTCCATGTAGGGCATCTTGGTC CYP2B6 ATGGGGCACTGAAAAAGACTGA AGAGGCGGGGACACTGAATGAC CYP2C8 GAGACAACAAGCACCACTCTGAG CAGTGTAAGGCATGTGGCTCCT CYP2C9 TCCTATCATTGATTACTTCCCG AACTGCAGTGTTTTCCAAGC CYP3A4 GCCTGGTGCTCCTCTATCTA GGTGTTGACCATCATAAAG CYP3A43 CTGCCTATGACACAACTAGCACC TACCAGGGCATCGTAGGTGACA CYP3A7 AAGTCTGGGGTATTTATGACT CGCTGGTGAATGTTGGAGAC EPHX1 GTTTTCCACCTGGACCAATACGG TGGTGCCTGTTGTCCAGTAGAG POR ACTCTGCTCTCGTCAACCAGCT TGGGTGCTTCTTGTTGGACTCC PXR GGACCAGCTGCAGGAGCAAT CATGAGGGGCGTAGCAAAGG RDH16 TATGGCGTGGAAGCCTTCTCTG GGTCCCAAATCTCCAGGAAGCT RPLP0 TCGACAATGGCAGCATCTAC GCCTTGACCTTTTCAGCAAG STEAP2 CCTCTGCTTACCGATGAGAAGG CAGGAGGGAAAGTAAGCCAAGG TAGLN TCCAGGTCTGGCTGAAGAATGG CTGCTCCATCTGCTTGAAGACC TSKU AGTCGCTTGACCTCAGCCACAA TCGTGAAGGCAGACACTGAGAC GO Number Biologic Process Count P Value Genes Deregulated by CITCO in the absence of EGF only GO.0042738 Exogenous drug catabolic process 6 1.09e−05 CYP1A2, CYP2A7, CYP2C19, CYP2C8, CYP2C9, CYP3A4 GO.0016098 Monoterpenoid metabolic process 4 4.66e−05 CYP1A2, CYP2C19, CYP2C9, CYP3A4 GO.0019373 Epoxygenase P450 pathway 5 0.000103 CYP1A2, CYP2A7, CYP2C19, CYP2C8, CYP2C9 GO.0042221 Response to chemical 41 0.000103 ADCY2, AKR1B1, ANXA3, CA3, CPEB3, CREB3L3, CTGF, CXCL5, CYP1A2, CYP2A7, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A7, EPHX1, ETV1, F2R, GSTA1, IL18, ITGA2, KCNA5, KRT19, MATN2, MICALL1, MRC1, MYL9, OR1C1, OR51B4, PANX1, PF4V1, POR, SERPINE1, SLC23A1, SOCS2, SOX2, TGFB2, TMEM67, TNFSF11, WNT6 GO.0050896 Response to stimulus 58 0.000166 ADCY2, AK7, AMOTL1, ANO1, BOC, CA3, CPE, CPEB3, CRIM1, CXCL5, CYP1A2, CYP2A7, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A7, DKK3, DST, EPHX1, ETV1, F2R, GSTA1, HRH4, IL18, ITGA2, KCNA5, KRT19, LRRN4, MAP4K5, MATN2, MCTP2, MICALL1, MRC1, MYL9, NABP1, OR1C1, OR51B4, PF4V1, PLK2, PNMA1, POR, RASEF, RRAD, RRM1, SERPINE1, SLC23A1, SOCS2, STK17A, SUSD4, TACSTD2, TGFB2, TMEM67, TNC, TNFSF11, VSIG4, WNT6 GO.0097267 Omega hydroxylase P450 pathway 4 0.000166 CYP1A2, CYP2C19, CYP2C8, CYP2C9 GO.0006805 Xenobiotic metabolic process 9 0.000299 CYP1A2, CYP2A7, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A7, GSTA1 GO.0071466 Cellular response to xenobiotic stimulus 9 0.00033 CYP1A2, CYP2A7, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A7, GSTA1 GO.0070989 Oxidative demethylation 4 0.00102 CYP1A2, CYP2C8, CYP2C9, CYP3A4 GO.1901700 Response to oxygen-containing compound 20 0.00389 ADCY2, AKR1B1, CA3, CPEB3, CTGF, CXCL5, CYP1A2, F2R, IGFBP1, IL18, KCNA5, MRC1, PANX1, PAX2, PF4V1, POR, SERPINE1, SOCS2, TGFB2, WNT6 Deregulated by CITCO in the presence of EGF only GO.0006397 mRNA processing 9 0.00486 DHX9, HNRNPC, MBNL2, RBM22, RBM27, SON, SRRM2, SYNCRIP, THRAP3 GO.0048255 mRNA stabilization 4 0.00486 DHX9, HNRNPC, SYNCRIP, THRAP3 GO.0016071 mRNA metabolic process 10 0.00533 DHX9, EIF4G1, HNRNPC, MBNL2, RBM22, RBM27, SON, SRRM2, SYNCRIP, THRAP3 GO.0008380 RNA splicing 8 0.0061 DHX9, HNRNPC, MBNL2, RBM22, SON, SRRM2, SYNCRIP, THRAP3 IGF, insulin-like growth factor.
GO Number Biologic Process Count P Value Genes Deregulated by PB only in medium without EGF GO.0008202 Steroid metabolic process 10 0.00081 ABCG1, AKR1B1, AKR1B10, CYP1A2, DHCR24, HMGCS1, HSD17B2, NSDHL, SLC27A2, TM7SF2 GO.0033993 Response to lipid 17 0.00081 ABCG1, ANKRD1, ANXA3, BAX, CDO1, CTGF, CXCL5, CYP1A2, HMGCS1, HSD17B2, INHBA, KLF4, KRAS, KRT19, MRC1, PELI1, SOCS3 GO.0006694 Steroid biosynthetic process 7 0.00273 AKR1B1, DHCR24, HMGCS1, HSD17B2, NSDHL, SLC27A2, TM7SF2 GO.0006629 Lipid metabolic process 18 0.0028 ABCG1, AKR1B1, AKR1B10, ANKRD1, BAX, CAV1, CTGF, CYP1A2, CYP2A7, DHCR24, ELOVL6, FADS1, HSD17B2, ME1, NSDHL, PNPLA3, RDH16, TM7SF2 GO.0044281 Small molecule metabolic process 26 0.0028 ABCG1, AKR1B10, ANKRD1, CAV1, CTGF, CTPS1, CYP1A2, CYP2A7, DHCR24, ELOVL6, ENTPD5, FADS1, GCAT, GLYAT, GSTA1, GSTA3, HMGCS1, HOGA1, MAT1A, ME1, NSDHL, PNPLA3, SLC23A1, SLC25A15, TM7SF2, UGT1A6 GO.0009725 Response to hormone 16 0.00289 ABCG1, AKR1B1, ANXA3, BAX, CAV1, CDO1, CTGF, CYP1A2, DHCR24, HMGCS1, IGFBP1, INHBA, KRT19, ME1, STEAP2, UGT1A6 GO.0042221 Response to chemical 35 0.00529 ABCG1, AKR1B1, ANKRD1, ANXA3, CAV1, CCL16, CDO1, CPEB3, CTGF, CTPS1, CUX2, CXCL5, CYP1A2, CYP2A7, DHCR24, FSTL3, GLYAT, GSTA1, GSTA3, HMGCS1, HSD17B2, KLF4, KRT19, MAT1A, MATN2, ME1, MRC1, MT1M, MYL9, NTN4, PELI1, SLC23A1, SLC47A1, STEAP2, UGT1A6 Deregulated by PB only in medium with EGF GO.0048255 mRNA stabilization 4 0.00728 DHX9, HNRNPC, SYNCRIP, THRAP3 Deregulated by PB in the presence and absence of EGF GO.0006805 Xenobiotic metabolic process 13 1.5e−13 CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A5, CYP3A7, CYP4A11, SULT2A1, UGT1A1, UGT1A8 GO.0071466 Cellular response to xenobiotic stimulus 13 1.5e−13 CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A5, CYP3A7, CYP4A11, SULT2A1, UGT1A1, UGT1A8 GO.0017144 Drug metabolic process 9 9.51e−13 CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A5, UGT1A1, UGT1A8 GO.0042737 Drug catabolic process 7 8.5e−11 CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A5 GO.0019373 Epoxygenase P450 pathway 6 4.24e−09 CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP4A11 GO.0042738 Exogenous drug catabolic process 6 7.24e−09 CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP3A4 GO.0032787 Monocarboxylic acid metabolic process 13 9.67e−09 AKR1D1, CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP4A11, FASN, PDK4, POR, SULT2A1, UGT1A1, UGT1A8 GO.0044281 Small molecule metabolic process 22 1.24e−08 ABCB1, AKR1D1, ALAS1, CYB5A, CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP3A4, CYP3A43, CYP3A5, CYP3A7, CYP4A11, DIO1, FASN, PDK4, POR, PRODH2, SULT2A1, UGT1A1, UGT1A8 GO.0019752 Carboxylic acid metabolic process 15 2.28e−08 AKR1D1, CYB5A, CYP2A6, CYP2B6, CYP2C19, CYP2C8, CYP2C9, CYP4A11, FASN, PDK4, POR, PRODH2, SULT2A1, UGT1A1, UGT1A8 GO.0008202 Steroid metabolic process 10 4.36e−08 AKR1D1, CYP2A6, CYP2B6, CYP2C19, CYP2C9, CYP3A4, CYP3A5, SULT2A1, UGT1A1, UGT1A8 siCT siCAR −EGF +EGF −EGF +EGF CITCO PB CITCO PB CITCO PB CITCO PB FC q-value FC q-value FC q-value FC q-value FC* q-value FC** q-value FC* q-value FC** q-value TAGLN 0.6 0.0 0.6 0.0 1.4 7.5 1.1 N.S. 1.4 0.0 N.S. N.S. N.S. RDH16 1.3 0.0 1.4 0,0 0.9 N.S. 1.1 N.S. 0.7 0.0 N.S. N.S. N.S. ALAS1 1.4 0.0 3.3 0.0 1.1 N.S. 2.3 0.0 0.7 0.0 N.S. N.S. N.S. POR 1.5 0.0 2.6 0.0 1.1 N.S. 2.4 0.0 0.7 0.0 N.S. N.S. N.S. CYP2C9 1.5 0.0 1.8 0.0 1.1 N.S. 1.8 0.0 0.7 0.0 N.S. 0.7 5.3 N.S. CPEB3 1.6 0.0 2.7 0.0 1.0 N.S. 1.3 N.S. 0.7 0.0 N.S. N.S. N.S. CYP2C8 1.7 0.0 2.3 0.0 1.1 N.S. 3.7 0.0 0.7 0.0 N.S. N.S. N.S. CYP3A43 1.9 0.0 5.4 0.0 1.0 N.S. 2.3 0.7 0.6 0.0 N.S. N.S. N.S. EPHX1 2.1 0.0 2.3 0.0 1.3 N.S. 1.7 0.4 0.6 0.0 N.S. N.S. N.S. TSKU 2.4 0.0 3.8 0.0 1.2 N.S. 3.1 0.0 0.5 0.0 N.S. N.S. N.S. CYP3A7 2.4 0.0 6.0 0.0 0.9 N.S. 11.4 1.0 0.5 0.0 N.S. N.S. N.S. CYP2A7 3.5 0.0 3.6 0.0 1.1 N.S. 1.3 N.S. 0.5 0.0 0.6 0.0 N.S. N.S. CYP3A4 3.8 0.0 14.4 0.0 1.1 N.S. 23.8 0.0 0.4 0.0 N.S. N.S. N.S. CYP2B6 10.5 0.0 10.7 0.0 2.1 1.3 5.6 0.0 0.3 0.0 0.5 0.0 0.7 5.3 N.S. CYP2A6 14.8 0.0 15.4 0.0 1.4 0.7 1.9 0.0 0.2 0.0 0.3 0.0 0.7 5.3 N.S. STEAP2 0.8 N.S. 0.6 0.0 0.9 N.S. 0.8 N.S. N.S. 1.4 2.4 N.S. N.S.
In this issue
Switch from CAR to PXR in the Presence of EGF
