Table 2

Primer pairs used to detect different CYP forms by RT-PCR

P-450 FormPrimer Sequence (5′–3′)Predicted Product Size
CYP1A1TGGATGAGAACGCCAATGTC237
GGATGAAGGCCTCCATATAG
CYP1A2ACAGCACTTCCCTGAGAGTA415
TCTGGATCTTCCTCTGTATC
CYP1B1GACATGATGGACGCCTTTAT569
AGCTGCATCTTAGAAAGTTC
CYP2A6GAACACAGAGCAGATGTACA708
TCCGTGTTGGGGTTCTTCTC
CYP2A7 2-aAAGCAGCTCCTGCGCTTTG481
CYP2B6AGTCCATTACCGCCAACATC753
TCTTTTTCAGTGCCCCATTG
CYP2CACACCAAGAATCAATGGACA540
GCTGAGAAAGGCATGAAGTA
CYP2D6TGATGAGAACCTGCGCATAG216
ACCTCATGAATCACGGCAGT
CYP2E1ACTATGGGATGGGGAAACAG353
CTCCTTCACCCTTTCAGACA
CYP2F1TGGGGAAGAGAAGCATTGAG486
CGCCAAAGAGCAGGTTATGT
CYP3A4CTGTGTGTTTCCAAGAGAAGTTAC626
ACCTCATGCCAATGCAGTTT
CYP3A5 2-bATTCATTCCCAAAGGGTCAA178
CYP3A7 2-bAGTCTGGGGTATTTATGACT1130
CYP4B1TAAGGCCCCTGATGTGTATG369
TGGTACTGGAAGGACACAAG

Primers unique for each form were designed with use of the DNASIS program. Forward primers are shown on top and reverse primers below.

  • 2-a Forward primer, reverse primer as for CYP2A6

  • 2-b Forward primer, reverse primer as for CYP3A4