Table 1

PCR primer pairs for FMO1, 3, 4 and 5 DOVAM-S analysis

Amplicon1-aDown (5′-3′)Up (5′-3′)Position1-150
F1X2 CTGAGCAAATCGCCTAATCT AGCCATTCTCCAATAGACAG −113 to 45
F1X3 GTGAGTTCTTCCCAGGCTTA CTAGGCTGGAGAGATAAGAG −57 to 71
F1X4 AACTGGCAAGTGCTTAATGG TCAAGCATCAGAATGGCTCC −62 to 59
F1X5 TGATCCTGTTAATTCTCTGT CCATTTGCTTGAGGCATGCA −45 to 62
F1X6 TGGCAGAACCAGCCAGCCGT GGCTCCTTCTTCCTAAAAGC −62 to 44
F1X7-1 GGAGAGCTGGCTGAATTGTT CAGATGTGCAGGGAAGATAT −58 to 256 (in exon)
F1X7-2 TTGAAGATGGCCAGGCCTCA CCAGTATCCAGAATCACATG 206 (in exon) to 60
F1X8 TAAGTCAACAGCTAGACCTA GTAACTTTCATCTCTCTCTGCT −60 to 127
F1X9-1 GCTTTGGGCACTTGTACTTG GTGAGCATCCGCCAAAGAAG −78 to 152 (in exon)
F1X9-2 CCTAACGGATCCACATCTGG GTGCATCTTCCATTTAGGAG 102 (in exon) to 29
F3X2 ACTGGAAATGTTCTCTGGGC TGTGTGCACACAGTGTGCTC −36 to 72
F3X3 CCTGACCATGATCAGTATAC GAGAATCCAGTAGTAGACAT −62 to 69
F3X4 GCTAGCATAGAAAAGAGGGA AGTTATGTGGCTAGCAGCTT −42 to 35
F3X5 CACAAGGTCGCTTCTGTT TGTCAGTAACGAGAGTCACC −76 to 41
F3X6 GGTGCTCACCAGAATATCCA GGGCTTACAGGACATTAAGG −65 to 75
F3X7-1 CTTGGGTCATTTTTTCCTTCC GATAGACTCATCAAGGAAGG −98 to 199 (in exon)
F3X7-2 TGGGACCATATTTGAGGGCA GTCACTGGCATTCATCTTCG 118 (in exon) to 48
F3X8 TGGTCCTATGCCAGACTCAT TCAGAAGCAACGTAGGTCTT −52 to 177
F3X9-1 CACAGAGTTTGGGTATCCAC AGTATGGCATTTCTGGCTCC −46 to 204 (in exon)
F3X9-2 GCCCTTGTAGTCCCTACCAG CCTGGTCTGGGTATTGTCAGT 135 (in exon) to 50
F4X2 GTTCTGCTTGACTTTCCTCT ATCACCAAGGCAGGCTAAAG −33 to 85
F4X3 CCAACAAGCTAACTATGCC AGATTGCTGAATAGGCCA −29 to 58
F4X4 ACACCAGTCATTGCATGAGG AACCCAGAAGCATAGGCATG −65 to 42
F4X5 CTATCCCTGCGTAGTGAGAA GATGATGGGATTAGGGGCAT −68 to 39
F4X6 TCCTTCTTGCCTTACTTTAC GATGAACAGTGTTTTAGGGA −27 to 143
F4X7-1 GAATGATGAGCTGCCAAACT GGTTTAAGGCAAAGACTTGC −29 to 201 (in exon)
F4X7-2 CCTCTTAAAAGCCTCTGTACA ACGATCCAAAGAGAGGACTT 141 (in exon) to 38
F4X8 GGAGGCTAGAAATGAGTGG CTGTAAGTTTGCCCTAGAGC −85 to 35
F4X9-1 ATGCAGGGCAGGTGTGATTA TGTTCTGTCCCACTGGGTCA −51 to 229 (in exon)
F4X9-2 TGGAGCCAGAAATGCCATCC ATAGCAGTTATGATGGAGAG 190 (in exon) to 92
F5X2 GGCGACACTAACAGGTGAAGA TTGCAGGGAGGGTTTCAAGT −33 to 46
F5X3 CATGAAGATGATCCTCAAG GGCAAACAACTTCAAACAC −49 to 44
F5X4 GATGTCCCCTGTGGTTATCA CACAGGCATGGGTCAAGGGT −33 to 44
F5X5 GGCAAGAAAGTAGCTGAGTAA TTCCTTGGAGAAACTGAAGC −138 to 60
F5X6 GGTTTACGAATCTGAGTGAC TGGCTTTACTATTAGCCAGTG −49 to 82
F5X7-1 CCACTTGATCTTTGTCACGA GGAATCTTCCAGAAACGGAA −27 to 196 (in exon)
F5X7-2 GCCACAGGCTATAGCTTTGA GTACCTAAACAGAGGTAAAC 155 (in exon) to 53
F5X8 GGATTATTGTTCCTTCTGAGG GAGGCAGTTAAATACAGTAC −57 to 85
F5X9-1 ATTGACAGGCCATGGTTTCT TGGAGTGCGGGTCCCAGTA −36 to 154 (in exon)
F5X9-2 TCACTGACCCCAAGCTGGCA GCTTCCCAATGAAAAACAGG 104 (in exon) to 38
  • 1-150  Indicates the position, relative to the exon, of the 5′ nucleotide of the downstream primer to the 5′ of the upstream primer.

  • 1-a  F1X2 corresponds to exon 2 from FMO1; F3X7 is exon 7 from FMO3 etc.