Table 2

PCR primer pairs for FMO2 and FMO6 DOVAM-S analysis

Amplicon2-aDown (5′-3′)Up (5′-3′)Position2-150
F2X2 CCGGTTGTCCCAGTTAAGTA CAACACAACCTGTTCAAGAC −52 to 39
F2X3 GTCGTCACACTGCAGCAACC CTGAACTAATGCAGAGAAACC −120 to 43
F2X4 GGCCAATGTTATCCTGGAGT TGAATCCTGCTTGTCAATCC −55 to 82
F2X5 AGCTGGCAATGCAGTTTTAT TGCCACAATGCGCTACCAAC −81 to 126
F2X6 CTAAACGGGACAATGCCCTA GTTAAGGGAGACACCTTCAG −50 to 71
F2X7-1 TCAAGAGGGTTCAAGATTCC GTTCTCCTCCACTGTTCCAT −64 to 136 (in exon)
F2X7-2 ACAGTGAAAGAGCTCACAGA CTTCACCAGATCTGAAACGC 77 (in exon) to 48
F2X8 CTGACTGGTATGACATGGTT GCAGCTAGGTGGTTCTTGTA −113 to 84
F2X9-1 CATTCTGTGAACATTCCC ACTAATAGGAGTTGCAGGGT −38 to 161 (in exon)
F2X9-2 TCCTAAACTGGCTGTGAGAC AGGAGGTAGTGACTGACAAG 112 (in exon) to 47
F6X2 TCTCTCCAGACTCTGCTACA TCCATCTCCTTCCACTGGTG −27 to 41
F6X3 GAACCACTGTGTTCACTGAAG CTCTAACCCACACATATCT −68 to 52
F6X4 CCACAGAAACAAGGCAAGAA GTTTGCATATAAGTCCCTAG −82 to 45
F6X5 CAGTTCAAACAACTTGCC GATTTAGTAGCACAGCCCT −31 to 57
F6X6-1 TGCCCAAAGAAGTGTGTTGT CCGGAGAAAGGATGCAAAGC −75 to 105 (in exon)
F6X6-2 CATGAGTCGGGTCTGGGATG GTTTCTAGGCTCAATGAGAC 33 (in exon) to 104
F6X7-1 CAATGTTATGGGCTGTTGCA TAGCCTGTTGCAAAGATGAC −77 to 165 (in exon)
F6X7-2 TGTGTTTGAGGATGGGACCA TTGTATCCCTAGCACAGTG 106 (in exon) to 89
F6X8 TCAAAGACATCTCCAGCTCC GGCACATTTTAGGACTTGC −137 to 48
F6X9-1 GCATAAATGGAGGTGCTATC CTGGGTCAGGATGGCATTT −92 to 232 (in exon)
F6X9-2 CAGTTTCGACTGATGGGACC TTCAAATGGGCCAAGACTGA 173 (in exon) to 148
  • 2-150  Indicates the position, relative to the exon, of the 5′ nucleotide of the downstream primer to the 5′ of the upstream primer.

  • 2-a  F2X2 corresponds to exon 2 from FMO2; F6X4 is exon 4 from FMO6 etc.