Table 1

Oligonucleotide probes for bDNA analysis of UGT mRNA levels

GeneGenBank No.Target1-aFunction1-bProbe Sequence
UGT1A3
D38067 270–288CE attttgaaggtggcccagcTTTTTctcttggaaagaaagt
D38067 544–566CE gaagaagggtttggactgtttgtTTTTTctcttggaaagaaagt
D38067 666–687CE cgccagagagccataattaacaTTTTTctcttggaaagaaagt
D38067 314–338LE gctgccattgtctgtagaactaactTTTTTaggcataggacccgtgtct
D38067 339–366LE cacatagaatgttgatacgttatttacaTTTTTaggcataggacccgtgtct
D38067 367–387LE cagcagacccctgcaagatctTTTTTaggcataggacccgtgtct
D38067 520–543LE tgcttcaaattccagttcacagagTTTTTaggcataggacccgtgtct
D38067 567–593LE ttcaatgttagtaacctgggaatataaTTTTTaggcataggacccgtgtct
D38067 644–665LE tggcataaatacatccatggcaTTTTTaggcataggacccgtgtct
D38067 710–730LE ctaccacggacacctccctctTTTTTaggcataggacccgtgtct
D38067 731–754LE atacagaggcatgtctgaggatctTTTTTaggcataggacccgtgtct
D38067 289–313BL tcagagaaaattcagtttcgaaaaa
D38067 594–616BL ctaggaagctcatgtggtcagaa
D38067 617–643BL caggataaagcatattcttcactctgt
D38067 688–709BL gcaaaaggtctgacgcaagtct
UGT1A8
D38063 63–81CE cctgcctgcctgagcaaagTTTTTctcttggaaagaaagt
D38063 145–165CE cacctcatgccctctgtgactTTTTTctcttggaaagaaagt
D38063 236–263CE tagtttaaatcttccagagtgttaagaaTTTTTctcttggaaagaaagt
D38063 42–62LE ccagaggccaggaacagacaaTTTTTaggcataggacccgtgtct
D38063 82–101LE tccatgggcactaccagcagTTTTTaggcataggacccgtgtct
D38063 121–144LE cagtttctccacaatcatctgcatTTTTTaggcataggacccgtgtct
D38063 166–188LE ctcacctctgggatgactaccacTTTTTaggcataggacccgtgtct
D38063 189–207LE cgactttcccatgtgccaaTTTTTaggcataggacccgtgtct
D38063 208–235LE ctagtagtagtttcacggtaaaattcaaTTTTTaggcataggacccgtgtct
D38063 102–120BL ggtgaaccagtggctcccg
UGT2B1
M13506 1156–1177CE tgcctcatagatgccatttgttTTTTTctcttggaaagaaagt
M13506 1248–1269CE ctaacagcagctcctttggctaTTTTTctcttggaaagaaagt
M13506 1606–1630CE tcagcctttatgatgctactctttcTTTTTctcttggaaagaaagt
M13506 1653–1672CE tctggaagcagctggcagagTTTTTctcttggaaagaaagt
M13506 1694–1716CE ctgtcttcttttagagggaaggcTTTTTctcttggaaagaaagt
M13506 1133–1155LE ccaccatgagctacaaaagctttTTTTTaggcataggacccgtgtct
M13506 1178–1201LE aacaataggaatgccatggtagatTTTTTaggcataggacccgtgtct
M13506 1202–1224LE tgatctgcaaacaagggaataccTTTTTaggcataggacccgtgtct
M13506 1225–1247LE ccatgtgattaatgttatccggtTTTTTaggcataggacccgtgtct
M13506 1582–1605LE ttcttctttcccatgttagcagtcTTTTTaggcataggacccgtgtct
M13506 1673–1693LE actggcatgacaacaggttccTTTTTaggcataggacccgtgtct
M13506 1717–1737LE atgttcaatgaggtcccaacgTTTTTaggcataggacccgtgtct
M13506 1631–1652BL gctcatctctcagggctctgct
UGT2B2
J02589 925–945CE caccgtgctctccagagctctTTTTTctcttggaaagaaagt
J02589 1176–1200CE ggattccatgatagattgcctcataTTTTTctcttggaaagaaagt
J02589 2421–2445CE acagaatgatttcctgttattggttTTTTTctcttggaaagaaagt
J02589 1158–1175LE gaggccattggctccaccTTTTTaggcataggacccgtgtct
J02589 1201–1224LE caaacagaggaatgccaatcatagTTTTTaggcataggacccgtgtct
J02589 900–924LE ggacaaattcttccatatccttaggTTTTTaggcataggacccgtgtct
J02589 2394–2420LE tgaatgtaaaatgtttcagataggtttTTTTTaggcataggacccgtgtct
UGT2B3
M31109 48–70CE ctgtagcaggagaagagcagaaaTTTTTctcttggaaagaaagt
M31109 586–612CE taagatggaggtaatataaatcttccaTTTTTctcttggaaagaaagt
M31109 1519–1538CE ccgaacaggtgagcaggaatTTTTTctcttggaaagaaagt
M31109 1641–1664CE aggctgaaatttcattcctgtagtTTTTTctcttggaaagaaagt
M31109 1–26LE aaatcaaaatccttactgttcacagtTTTTTaggcataggacccgtgtct
M31109 27–47LE tccacttcccaggcatcttaaTTTTTaggcataggacccgtgtct
M31109 562–585LE ctggacttttcaattttgtagcctTTTTTaggcataggacccgtgtct
M31109 613–637LE cattcctgacaaaattactggtacaTTTTTaggcataggacccgtgtct
M31109 1539–1563LE tttacagtaaggactgcaatgactgTTTTTaggcataggacccgtgtct
M31109 1589–1613LE tcattttcttttccttcttcacaaaTTTTTaggcataggacccgtgtct
M31109 1614–1640LE gcattgtaaatgagctctactcattctTTTTTaggcataggacccgtgtct
M31109 1564–1588BL gagtcggtaaataaacaagaagcat
UGT2B6
M33747 433–457CE attcttcattttcttttgcttctttTTTTTctcttggaaagaaagt
M33747 481–505CE tgaggcttaaatttcattcctgtagTTTTTctcttggaaagaaagt
M33747 944–963CE tgctctgcttttccctggagTTTTTctcttggaaagaaagt
M33747 991–1014CE ttcctatctatcctgcgttctcagTTTTTctcttggaaagaaagt
M33747 1273–1297CE ttgaggttatggaatctttctttttTTTTTctcttggaaagaaagt
M33747 1374–1402CE aaataagaattaagaaacaggtttatttcTTTTTctcttggaaagaaagt
M33747 366–387LE gcaatgactgccaaacaggctaTTTTTaggcataggacccgtgtct
M33747 388–408LE aagcattttacagcaagggctTTTTTaggcataggacccgtgtct
M33747 458–480LE tgcattgtcaacgagctctactcTTTTTaggcataggacccgtgtct
M33747 922–943LE atgcttttggtcagcacattttTTTTTaggcataggacccgtgtct
M33747 964–990LE gatctgtaagcacaactcaaaataaacTTTTTaggcataggacccgtgtct
M33747 1298–1322LE cattttccaaaatttgtaatgctgtTTTTTaggcataggacccgtgtct
M33747 1323–1346LE cagataggctgatgaattttagcaTTTTTaggcataggacccgtgtct
M33747 1347–1373LE ctgttatggattcaatgtaaaatgtttTTTTTaggcataggacccgtgtct
M33747 409–432BL gcaaagaatcggtaaatgaacaag
UGT2B8
U27518 67–90CE tcccagatctgaagcagaaacttaTTTTTctcttggaaagaaagt
U27518 113–134CE ccagtgactgtattccaatggcTTTTTctcttggaaagaaagt
U27518 187–210CE cggaagatgaaggtctgagaacagTTTTTctcttggaaagaaagt
U27518 1258–1282CE aaatctatagaaacagctgctccttTTTTTctcttggaaagaaagt
U27518 1308–1328CE gactgccttcagtgcgttgagTTTTTctcttggaaagaaagt
U27518 1398–1420CE cagaagactgctctgtccagaggTTTTTctcttggaaagaaagt
U27518 23–44LE aatccacttctgaggcatcctgTTTTTaggcataggacccgtgtct
U27518 91–112LE cacaccaacactttcccacagtTTTTTaggcataggacccgtgtct
U27518 135–163LE agttcatccagtattatctttaaattcatTTTTTaggcataggacccgtgtct
U27518 164–186LE tgacttcatgtcccctctgtacaTTTTTaggcataggacccgtgtct
U27518 234–259LE ggagatgtttcatatacaagaccagaTTTTTaggcataggacccgtgtct
U27518 1213–1237LE ttatcacgttgttctgcaaataaagTTTTTaggcataggacccgtgtct
U27518 1238–1257LE tggctaccatgtgagcaacgTTTTTaggcataggacccgtgtct
U27518 1355–1376LE aatggctgacaaccacatcactTTTTTaggcataggacccgtgtct
U27518 1377–1397LE cttcagaggctggtcatggtgTTTTTaggcataggacccgtgtct
U27518 45–66BL tctgcagtaggagcagagcaga
U27518 211–233BL tgcttttttgggatcaagagaga
U27518 1283–1307BL caaatctgaactggacattgtatga
U27518 1329–1354BL ttctttttataggaggggttattgat
UGT2B12
U06273 47–70CE cagttcccagatttaaagcagaaaTTTTTctcttggaaagaaagt
U06273 520–540CE tgtagccaggagagaagcgaaTTTTTctcttggaaagaaagt
U06273 1045–1069CE ttgtagagtctggtattgggtcctaTTTTTctcttggaaagaaagt
U06273 1133–1153CE gcctcatagatgccattggctTTTTTctcttggaaagaaagt
U06273 1177–1196CE tgcaaataagggaatgccaaTTTTTctcttggaaagaaagt
U06273 25–46LE cttatttgcagcaggagcagagTTTTTaggcataggacccgtgtct
U06273 71–90LE gccataccaacacctttccgTTTTTaggcataggacccgtgtct
U06273 471–494LE cagttcagctatcagctctccacaTTTTTaggcataggacccgtgtct
U06273 541–565LE actcctccaatgtactgttcaattgTTTTTaggcataggacccgtgtct
U06273 566–589LE ggtacataggagggagggaatagaTTTTTaggcataggacccgtgtct
U06273 1026–1044LE aggtgggtggttttttgccTTTTTaggcataggacccgtgtct
U06273 1112–1132LE ccaccatgcgttacaaaggctTTTTTaggcataggacccgtgtct
U06273 1154–1176LE tcatagggattccatgatggatcTTTTTaggcataggacccgtgtct
U06273 1197–1218LE gggcaatgttatcatgttgctcTTTTTaggcataggacccgtgtct
U06273 495–519BL gactgtacagaaaaggaatctggag
U06273 1070–1089BL gatcattttggggaagccac
U06273 1090–1111BL ttggtttttggatgaccaagaa
  • 1-a Target refers to the sequence of mRNA transcript as enumerated in the GenBank file.

  • 1-b Function refers to the utility of the oligonucleotide probe in the bDNA assay.