TABLE 2

Primer sequences, annealing temperatures, and restriction endonuclease enzymes for A-RFLP typing of Cyp3A5


Allele/SNP

Primer Name

Primer Sequence

Annealing Temperature

Restriction Enzyme

Digestion Products
°C
Cyp3A5*2 5Ex11f CTTCACGAATACTATGATCATTTACC 60 Tsp5091 (NEB) Wt: 310,90,22
5Ex11r GGCAGAATATGCTTGAACCAGC Mt:187,123,90,22
Cyp3A5*3 3A5A3f CATGACTTAGTAGACAGATGA 56 Ssp I (NEB) Wt: 148,125,20
3A5A3r GGTCCAAACAGGGAAGAAATA Mt: 168,125
Cyp3A5*5 3A5A5f CCATGAAGATCACCACAACT 56 Nla III (NEB) Wt: 218
3A5A5r CCTGTCCCCAGATTCATTC Mt: 172,46
Cyp3A5*6 5Ex7f GCATGTATAGTGGAAGGACG 60 Dde I (NEB) Wt: 103,60,87,25
5Ex7r GAATTATATGTCAAGAAAGCAG Mt: 128,87,60
SNP 31611 C3A512f ACCCTAAGTGGAGGAATGAGT 60 Sca 1 (NEB) Wt: 209
(3′-Untranslated region) TATTCTAAGT Mt: 181,29

5Ex13r
TCCTTTATACTACATAATGCACAAC



  • NEB, New England Biolabs (Beverly, MA); Wt, wild-type; Mt, mutant.