TABLE 1

q-PCR primers and conditions

PCR primers used for the q-PCR analysis of target FMO genes and housekeeping genes are listed with their exon location indicated. Validated q-PCR conditions including annealing temperature (Tm), Mg2+ concentration (Mg2+), primer concentration (Primer), and amplification efficiency (E) calculated from standard curves are listed.


Target Gene

Primers and Exon

Primer Sequence

Tm

Mg2+

Primer

E
mM nM
hFMO1 F1F711, ex5/6 acctggcggaaaaggtgt 55°C 4 400 1.87
F1R823, ex6 catgttctgaaagcgtgtcat 800
hFMO2 F2F1187, ex7 gttccattttcccaactgct 54°C 4 400 1.65
F2R1333, ex9 tctggctttctccaaacaggt 800
hFMO3 F3F1223, ex7 ctgccattcccacagttgac 55°C 3 800 2.0
F3R1420, ex9 ccccaatgaaggaggagagt 400
hFMO4 F4F627, ex4 ggactatctccaagaatttgctg 54°C 4 400 1.96
F4R755, ex5 ctctattttgcttgccctctg 800
hFMO5 F5F1273, ex8 acattgccctcacagagtgaa 54°C 4 400 1.86
F5R1411, ex9 ccaccaaatcagcaagctct 200
HPRT HPRTF407ex4 gaccagtcaacaggggacat 56.5°C 4.5 800 2.13
HRPTR588 ex7 gtccttttcaccagcaagct 800
TBP TBPF243 ex2 acaacagcctgccaccttac 55°C 3 500 2.01

TBPR430 ex3
ctgctgctgttgttgttgct


500