TABLE 1

PCR primers


Gene

GenBank Accession No.

PCR Primer Sequences (5′ to 3′)

PCR Product Size
bp
Genotyping and Gender-Typing Primers
    zfy AC139318.5 Fw:cctattgcatgacagcagtcttatg 185
Rv:gactagacatgtcttaacatctgtcc
    Abcb1a wild-type NM_011076 Fw:cagctccatccaacaacttc 411
Rv:gacacaggtactgtccacag
    Abcb1a mutant NM_011076 Fw:atgtcctgcgggtaaatagc 481
Rv:cgtcaggacattgttggagc
    mEH AC119911.10 Fw:aagtgagtttgcatggcgcagc 367
Rv:ccctttagccccttccctctg
Quantitative PCR Primers
    Abcb1a NM_011076 Fw:gagtgaggccgataaaagagccatgtt 248
Rv:tcatctgtgagccgggtgttgagctccc
    Abcb1b NM_011075 Fw:gctgttggcgtatttgggatgtttcg 210
Rv:gatgatcagagtactgttgggtccac
    rpII U37500 Fw:ctggacctaccggcatgttc 132


Rv:gtcatcccgctcccaacac

  • Fw, forward; Rv, reverse.