TABLE 1

Primer pairs and probes used to measure human P450 genes by Q-PCR


Gene (GenBank Accession Number)

Type of Oligo

Sequence (5′→3′)

Position
CYP1A1 (XM_113272) Primer (forward) accttccgacactcttccttcg 1245-1266
Primer (reverse) cagatgggttgacccatagcttct 1398-1375
Probe cttcaccatcccccacagcacaacaag 1271-1297
CYP1A2 (NM_000761) Primer (forward) ccttccgacactcctccttcttg 1188-1210
Primer (reverse) gggatgtagaagccattcagcg 1269-1248
Probe cttcaccatcccccacagcacaacaag 1213-1239
CYP2E1 (AF182276) Primer (forward) caagccattttccacagga 1289-1307
Primer (reverse) caacaaaagaaacaactccatgc 1361-1339
Probe tgctggag 1319-1326
CYP3A4 (NM_017460) Primer (forward) cacagatccccctgaaattaagctta 1516-1541
Primer (reverse) aaaattcaggctccacttacggtg 1621-1598
Probe aggacttcttcaaccagaaaaacccgttgttct 1544-1576
CYP3A5 (NM_000777) Primer (forward) acagatccccttgaaattagacacg 1497-1521
Primer (reverse) cttagggttccatctcttgaatcca 1586-1562
Probe aaggacttcttcaaccagaaaaacccattgttcta 1523-1557
CYP3A7 (NM_000765) Primer (forward) tcagaacttctccttcaaaccttgtaa 1485-1511
Primer (reverse) gcctttagaacaatgggtttttctgtta 1583-1556
Probe aaacacagatccccctgaaattacgctttggag 1514-1546
β-Actin (X00351) Primer (forward) aaccccaaggccaaccg 372-388
Primer (reverse) agggatagcacagcctgga 466-448
Probe atgacccagatcatgtttgagaccttcaacac 396-427
Glyceraldehyde-3-phosphate dehydrogenase (BC08351) Primer (forward) tcctgcaccaccaactgctt 503-522
Primer (reverse) gaggggccatccacagtctt 627-608
Probe actcatgaccacagtccatgccatcac 571-597
18S (X03205) Primer (forward) ctcaacacgggaaacctcac 1247-1266
Primer (reverse) cgctccaccaactaagaacg 1356-1337

Probe
ggtggtgg
1321-1328