TABLE 1

Oligonucleotide probes generated for analysis of mouse Mdr1b expression by bDNA signal amplification


Function

Probe Sequence
CE ttattaaaggtgatttggattcttctTTTTTctcttggaaagaaagt
CE cttctctcttggtcttgctttctgTTTTTctcttggaaagaaagt
CE gatttagatttaggatccgccaaTTTTTctcttggaaagaaagt
CE tgaagccctgaaagaaatatgtaaTTTTTctcttggaaagaaagt
CE ggactcgcttggtgaggatctTTTTTctcttggaaagaaagt
CE atgactcctgtcccgaggtttTTTTTctcttggaaagaaagt
LE tggacacttctgtaaattgatctccTTTTTaggcataggacccgtgtct
LE aacaagtaaataaggccattcacttaTTTTTaggcataggacccgtgtct
LE acactggttgtatgcacccattTTTTTaggcataggacccgtgtct
LE caattctgtcgtttagtttcatggtTTTTTaggcataggacccgtgtct
LE cgaaccagcttatatcctgtctcaTTTTTaggcataggacccgtgtct
LE gctacattctgggtaactacagcaagTTTTTaggcataggacccgtgtct
LE gccagccatagactaaggagaggTTTTTaggcataggacccgtgtct
LE ttccgcccaatacaatgagcTTTTTaggcataggacccgtgtct
LE
LE ccagacaacagcttcatttcaataaTTTTTaggcataggacccgtgtct
LE tcttcccagagatctcaagctgtTTTTTaggcataggacccgtgtct
BL agttttcaattgcttctgtagcaaTTTTTaggcataggacccgtgtct
BL catccacagcctctttcatactaagt
BL aaggaaaccagaggcacatctt
BL tataacagcgcaaagtacgcc
BL caatccttgaaaatactatggcaa
BL catcatctcttgaaaaaaccccta
BL cagaaagaacagggaaaacaaatta
BL caaaagaaatcagccccataac
BL ctccggctttgccaaatg
BL gcatggatttgaaaaccatgtatc
BL gccagtgctgttcttatggtcat
BL gcgagcctggtggtcagtga
BL ccctttaacactagaagcatcactg
BL cctggcgcccatcgc
BL ggtataattactacaagtagaagtgtcagct
BL
ttcttgtccttcaaggcttgg
  • CE, capture extender; LE, label extender; BL, blocker probe.