TABLE 1

Primers used for amplification of CYP3A7 cDNA site-directed mutagenesis

The oligonucleotides used to introduce the different substitutions are underlined with the specific change.


Amino Acid

3A7

3A4

5′-3′
N116S Asn (N) Ser (S) TTATGAAAAGTGCCATCTC
H174D His (H) Asp (D) ACCTTGAAAGACGTCTTTG
N214D Asn (N) Asp (D) AGATTTGATCCATTAGATCC
K224T Lys (K) Thr (T) TCTCAATAACAGTCTTTCC
K244E Lys (K) Glu (E) TTCCAAGAGAAGTTATAAG
K262E
Lys (K)
Glu (E)
GGTCGCCTCGAAGAGACAC