TABLE 1

Sequences of the primers for semiquantitative real-time RT-PCR


Transporter Name

Sequence (5′ → 3′)
Oatp1a1
    Forward actgggcagatacgaaatatgaaacaacgat
    Reverse gtccaaaaattgggccagcaaccttcccca
Oatp1b2
    Forward tgggatattacaagtatgcaaaagaaaacg
    Reverse
actgttcaggtctacatatccaacgtctac