Oligonucleotides used for the UGT1A1 bisulfite analysis and ChIP assay and for the cloning of HNF1α
Nucleotides are numbered with the transcription start site designated as +1 in the UGT1A1 genomic DNA sequence and base A in the initiation codon ATG designated as +1 in the HNF1α cDNA sequence.
| Oligonucleotides | 5′ to 3′ Sequence | Position |
|---|---|---|
| Bisulfite analysis of UGT1A1 | ||
| Forward | TTTGTGGATTGATAGTTTTTTATAG | −113 to −89 |
| Reverse | CAATAACTACCATCCACTAAAATC | +134 to +111 |
| ChIP assay of UGT1A1 | ||
| Forward | CTACCTTTGTGGACTGACAGC | −118 to −98 |
| Reverse | CAACAGTATCTTCCCAGCATG | +111 to +91 |
| Cloning of HNF1α | ||
| Forward | GCAGCCGAGCCATGGTTTCT | −11 to +9 |
| Reverse | GGTGCCGTGGTTACTGGGA | +1906 to +1888 |
ChIP, chromatin immunoprecipitation; HNF, hepatocyte nuclear factor; UGT, uridine 5′-diphospho-glucuronosyltransferase.