TABLE 1

Sequences of primers for real-time PCR analysis

Gene NameSense (5′→3′)Antisense (5′→3′)Product Length (bp)
LGR5TGCTCTTCACCAACTGCATCCTCAGGCTCACCAGATCCTC193
EphB2AAAAGGGCTTGGGAGATTCATGTCCATCTGTCCCGTCCTC215
Sucrase-isomaltaseGGTAAGGAGAAACCGGGAAGGCACGTCGACCTATGGAAAT195
Villin 1AGCCAGATCACTGCTGAGGTTGGACAGGTGTTCCTCCTTC169
ISXCAGGAAGGAAGGAAGAGCAATGGGTAGTGGGTAAAGTGGAA96
SLC15A1/PEPT1CACCTCCTTGAAGAAGATGGCAGGGAAGACTGGAAGAGTTTTATCG105
ABCG2/BCRPAGATGGGTTTCCAAGCGTTCATCCAGTCCCAGTACGACTGTGACA91
ABCB1/MDR1CCCATCATTGCAATAGCAGGTGTTCAAACTTCTGCTCCTGA158
CYP3A4CTGTGTGTTTCCAAGAGAAGTTACTGCATCAATTTCCTCCTGCAG298
GAPDHGAGTCAACGGATTTGGTCGTGACAAGCTTCCCGTTCTCAG185